ID: 1122262651

View in Genome Browser
Species Human (GRCh38)
Location 14:100531940-100531962
Sequence ATGCCCCACACCTGCATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122262637_1122262651 8 Left 1122262637 14:100531909-100531931 CCCTTTCCCCACAGATCCCCCGG No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262643_1122262651 -8 Left 1122262643 14:100531925-100531947 CCCCCGGCCCCACCGATGCCCCA No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262642_1122262651 0 Left 1122262642 14:100531917-100531939 CCACAGATCCCCCGGCCCCACCG No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262641_1122262651 1 Left 1122262641 14:100531916-100531938 CCCACAGATCCCCCGGCCCCACC No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262644_1122262651 -9 Left 1122262644 14:100531926-100531948 CCCCGGCCCCACCGATGCCCCAC No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262645_1122262651 -10 Left 1122262645 14:100531927-100531949 CCCGGCCCCACCGATGCCCCACA No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262632_1122262651 24 Left 1122262632 14:100531893-100531915 CCTGTCACCCTCAGCCCCCTTTC No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262633_1122262651 17 Left 1122262633 14:100531900-100531922 CCCTCAGCCCCCTTTCCCCACAG No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262639_1122262651 7 Left 1122262639 14:100531910-100531932 CCTTTCCCCACAGATCCCCCGGC No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262640_1122262651 2 Left 1122262640 14:100531915-100531937 CCCCACAGATCCCCCGGCCCCAC No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262636_1122262651 9 Left 1122262636 14:100531908-100531930 CCCCTTTCCCCACAGATCCCCCG No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262634_1122262651 16 Left 1122262634 14:100531901-100531923 CCTCAGCCCCCTTTCCCCACAGA No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262635_1122262651 10 Left 1122262635 14:100531907-100531929 CCCCCTTTCCCCACAGATCCCCC No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122262651 Original CRISPR ATGCCCCACACCTGCATTTG TGG Intergenic
No off target data available for this crispr