ID: 1122262657

View in Genome Browser
Species Human (GRCh38)
Location 14:100531958-100531980
Sequence TGTGGTGGAGCACATGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122262643_1122262657 10 Left 1122262643 14:100531925-100531947 CCCCCGGCCCCACCGATGCCCCA No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262649_1122262657 1 Left 1122262649 14:100531934-100531956 CCACCGATGCCCCACACCTGCAT No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262641_1122262657 19 Left 1122262641 14:100531916-100531938 CCCACAGATCCCCCGGCCCCACC No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262637_1122262657 26 Left 1122262637 14:100531909-100531931 CCCTTTCCCCACAGATCCCCCGG No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262647_1122262657 3 Left 1122262647 14:100531932-100531954 CCCCACCGATGCCCCACACCTGC No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262642_1122262657 18 Left 1122262642 14:100531917-100531939 CCACAGATCCCCCGGCCCCACCG No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262636_1122262657 27 Left 1122262636 14:100531908-100531930 CCCCTTTCCCCACAGATCCCCCG No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262646_1122262657 7 Left 1122262646 14:100531928-100531950 CCGGCCCCACCGATGCCCCACAC No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262648_1122262657 2 Left 1122262648 14:100531933-100531955 CCCACCGATGCCCCACACCTGCA No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262639_1122262657 25 Left 1122262639 14:100531910-100531932 CCTTTCCCCACAGATCCCCCGGC No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262645_1122262657 8 Left 1122262645 14:100531927-100531949 CCCGGCCCCACCGATGCCCCACA No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262635_1122262657 28 Left 1122262635 14:100531907-100531929 CCCCCTTTCCCCACAGATCCCCC No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262654_1122262657 -9 Left 1122262654 14:100531944-100531966 CCCACACCTGCATTTGTGGTGGA No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262652_1122262657 -8 Left 1122262652 14:100531943-100531965 CCCCACACCTGCATTTGTGGTGG No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262640_1122262657 20 Left 1122262640 14:100531915-100531937 CCCCACAGATCCCCCGGCCCCAC No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262655_1122262657 -10 Left 1122262655 14:100531945-100531967 CCACACCTGCATTTGTGGTGGAG No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262644_1122262657 9 Left 1122262644 14:100531926-100531948 CCCCGGCCCCACCGATGCCCCAC No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262650_1122262657 -2 Left 1122262650 14:100531937-100531959 CCGATGCCCCACACCTGCATTTG No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122262657 Original CRISPR TGTGGTGGAGCACATGCCCC AGG Intergenic
No off target data available for this crispr