ID: 1122262659

View in Genome Browser
Species Human (GRCh38)
Location 14:100531963-100531985
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122262642_1122262659 23 Left 1122262642 14:100531917-100531939 CCACAGATCCCCCGGCCCCACCG No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262654_1122262659 -4 Left 1122262654 14:100531944-100531966 CCCACACCTGCATTTGTGGTGGA No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262656_1122262659 -10 Left 1122262656 14:100531950-100531972 CCTGCATTTGTGGTGGAGCACAT No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262655_1122262659 -5 Left 1122262655 14:100531945-100531967 CCACACCTGCATTTGTGGTGGAG No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262641_1122262659 24 Left 1122262641 14:100531916-100531938 CCCACAGATCCCCCGGCCCCACC No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262645_1122262659 13 Left 1122262645 14:100531927-100531949 CCCGGCCCCACCGATGCCCCACA No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262650_1122262659 3 Left 1122262650 14:100531937-100531959 CCGATGCCCCACACCTGCATTTG No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262643_1122262659 15 Left 1122262643 14:100531925-100531947 CCCCCGGCCCCACCGATGCCCCA No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262649_1122262659 6 Left 1122262649 14:100531934-100531956 CCACCGATGCCCCACACCTGCAT No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262648_1122262659 7 Left 1122262648 14:100531933-100531955 CCCACCGATGCCCCACACCTGCA No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262639_1122262659 30 Left 1122262639 14:100531910-100531932 CCTTTCCCCACAGATCCCCCGGC No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262640_1122262659 25 Left 1122262640 14:100531915-100531937 CCCCACAGATCCCCCGGCCCCAC No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262644_1122262659 14 Left 1122262644 14:100531926-100531948 CCCCGGCCCCACCGATGCCCCAC No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262646_1122262659 12 Left 1122262646 14:100531928-100531950 CCGGCCCCACCGATGCCCCACAC No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262652_1122262659 -3 Left 1122262652 14:100531943-100531965 CCCCACACCTGCATTTGTGGTGG No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262647_1122262659 8 Left 1122262647 14:100531932-100531954 CCCCACCGATGCCCCACACCTGC No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122262659 Original CRISPR TGGAGCACATGCCCCAGGCT GGG Intergenic
No off target data available for this crispr