ID: 1122263747

View in Genome Browser
Species Human (GRCh38)
Location 14:100537350-100537372
Sequence CCGGGACGATGGGCCGTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122263726_1122263747 28 Left 1122263726 14:100537299-100537321 CCCGGGGGCGGAGATGAGCACCG 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1122263747 14:100537350-100537372 CCGGGACGATGGGCCGTGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 117
1122263734_1122263747 4 Left 1122263734 14:100537323-100537345 CCGCACTGGGGCATCATCCCGGC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1122263747 14:100537350-100537372 CCGGGACGATGGGCCGTGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 117
1122263727_1122263747 27 Left 1122263727 14:100537300-100537322 CCGGGGGCGGAGATGAGCACCGG 0: 1
1: 0
2: 1
3: 6
4: 155
Right 1122263747 14:100537350-100537372 CCGGGACGATGGGCCGTGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 117
1122263732_1122263747 8 Left 1122263732 14:100537319-100537341 CCGGCCGCACTGGGGCATCATCC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1122263747 14:100537350-100537372 CCGGGACGATGGGCCGTGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122263747 Original CRISPR CCGGGACGATGGGCCGTGGG AGG Exonic
900088655 1:909930-909952 CCGGGAGGAAGGACCGAGGGTGG + Intergenic
900926539 1:5709702-5709724 CAGGGAAGATGGGAGGTGGGAGG - Intergenic
904292590 1:29497582-29497604 GCGGGAAGATGGACCCTGGGTGG - Intergenic
904451947 1:30619019-30619041 CAGGGATGAAGGGCTGTGGGTGG - Intergenic
904755436 1:32766161-32766183 CGGGGAGGATGGGACGTGGGCGG + Intronic
905596965 1:39215801-39215823 GCGGGAGGATGGGGGGTGGGAGG + Intronic
910206575 1:84754390-84754412 CAGGTGCGATGGGCAGTGGGGGG - Intergenic
914170238 1:145216041-145216063 CCGGGACCAACCGCCGTGGGGGG + Intergenic
919730609 1:200911691-200911713 CGGTGACGATGGGTCTTGGGAGG - Exonic
919878861 1:201889226-201889248 CCAGGATGCTGGGCCATGGGAGG + Intronic
920216220 1:204363146-204363168 CCCGGAGGAGGGGCCCTGGGAGG - Intronic
1064131535 10:12714075-12714097 CCGTGACCATGGGCTGTGGCAGG - Intronic
1073136848 10:101224927-101224949 CCGGGACGAATGGGCCTGGGCGG - Intergenic
1075087926 10:119426039-119426061 CAGGGACTCTGGGCTGTGGGAGG - Intronic
1077112482 11:868021-868043 CCGGGGGGATGGGCAGAGGGTGG - Exonic
1077213254 11:1383132-1383154 CTGGGCCGAGGGCCCGTGGGGGG - Intergenic
1078577786 11:12516416-12516438 CGGGGATGATGGACCTTGGGAGG - Intronic
1084093405 11:66894250-66894272 CCGGGAGGCTGGGGCATGGGGGG - Intronic
1089540747 11:119187858-119187880 CTGGGAGGAGGGGCTGTGGGGGG + Intronic
1091934317 12:4423227-4423249 CGGGGACGCTGTGCAGTGGGTGG - Intergenic
1095949356 12:47773446-47773468 CCGGGACGCTGGGCGGCGCGGGG + Intronic
1101340946 12:103841344-103841366 CGGGGTCGATGGGGAGTGGGCGG + Intergenic
1101965101 12:109276988-109277010 CTGGGAGGATGGGCTATGGGTGG - Intergenic
1104946681 12:132417752-132417774 GCAGGAGGCTGGGCCGTGGGAGG - Intergenic
1107603918 13:42040487-42040509 CCGGGAGGAGGGGCGGCGGGGGG + Intronic
1107714015 13:43180662-43180684 CCGGGCAGATGGAGCGTGGGTGG - Intergenic
1121107910 14:91293095-91293117 ACGGGAAGGTGGGCCGTGGCAGG - Intronic
1121108007 14:91293415-91293437 ACGGGAAGGTGGGCCGTGGCAGG - Intronic
1122263747 14:100537350-100537372 CCGGGACGATGGGCCGTGGGAGG + Exonic
1122551954 14:102555239-102555261 CCAGGACGATCGGCCGGTGGGGG + Intergenic
1123174168 14:106401466-106401488 CGGGGCTGATGGGACGTGGGCGG - Intergenic
1123182376 14:106482399-106482421 CGGGGCTGATGGGACGTGGGCGG - Intergenic
1202944527 14_KI270726v1_random:14331-14353 CGGGGCTGATGGGACGTGGGCGG + Intergenic
1124999383 15:34754777-34754799 CCGGGACGAGGGGCGGGGCGGGG + Exonic
1128528966 15:68431446-68431468 CCGGGGCGATGGCCGGTAGGCGG - Intronic
1132714229 16:1282756-1282778 CCGGGAGGCTGGGCTGTGTGTGG + Intergenic
1135960058 16:26987773-26987795 CCAGGAACATGGGTCGTGGGAGG + Intergenic
1142560531 17:806518-806540 CCCGAAGGGTGGGCCGTGGGTGG - Intronic
1142664657 17:1455843-1455865 ACGGGACGGCGGGCCCTGGGCGG - Intronic
1143090508 17:4446859-4446881 CAGGGGCGATGGGCTGTGAGGGG - Intronic
1146382572 17:32341900-32341922 CCGGGCCGCTGGGCCGGGGGTGG + Intronic
1146531398 17:33610450-33610472 GCGGGGCAATGGGCGGTGGGGGG - Intronic
1147599619 17:41737869-41737891 CCAGGAAGCTGGGCTGTGGGAGG - Intergenic
1148323593 17:46771367-46771389 CGGGGAAGAGGGGCCGAGGGCGG + Intronic
1151716297 17:75832807-75832829 CAGGAAAGAGGGGCCGTGGGAGG + Intronic
1151716328 17:75832897-75832919 CAGGAAGGAGGGGCCGTGGGAGG + Intronic
1152702024 17:81824038-81824060 CCGGGAGGAGGGGCTGGGGGTGG - Intronic
1157473689 18:48008320-48008342 CGGGGGCGCTGGGCCGGGGGCGG + Intergenic
1157555366 18:48609982-48610004 CCGGGCCCATTGGCAGTGGGCGG + Intronic
1157608188 18:48939456-48939478 CCGGGAGGAAGGGGAGTGGGCGG - Intronic
1159002437 18:62986400-62986422 GAAGGACGATGGGGCGTGGGGGG + Intergenic
1160861292 19:1238130-1238152 TCGTGCCGATGGGCCGGGGGCGG - Intergenic
1160969383 19:1760642-1760664 CAGAGAGGATGGGCGGTGGGGGG + Intronic
1161224460 19:3136603-3136625 CAGGGTCGGTGGGCGGTGGGTGG + Intronic
1162064426 19:8116643-8116665 CCGGGACGGTGGGGCGGGGCGGG - Intronic
1164784674 19:30920538-30920560 CCGGGAAGGTGGGGGGTGGGGGG + Intergenic
1165172058 19:33900539-33900561 CCGAGAAGATGGGCCGGGTGTGG + Intergenic
1166245346 19:41522001-41522023 CCGGGAGGATGAGCGGTGTGGGG - Intergenic
1166545530 19:43632660-43632682 CTGGGAAGATGGGGCTTGGGAGG - Intronic
1166709449 19:44927305-44927327 ATGGGGCGATGGGCTGTGGGAGG + Intergenic
1166856502 19:45785007-45785029 CCTGTAGGATGGGCAGTGGGTGG - Intronic
1167115567 19:47487451-47487473 CAGGGACGGTGGGCCTGGGGAGG - Intergenic
1167538125 19:50068441-50068463 CCGGGAGGCTGGGAGGTGGGAGG - Intergenic
1167620378 19:50556931-50556953 CCGTGGCAATGGGCCGGGGGCGG + Intronic
1168341062 19:55623322-55623344 CCTGGAGGATGGGCCGGGCGCGG - Intronic
925297481 2:2787490-2787512 CCTTGACGATGGCCCGTGGCCGG + Intergenic
925826074 2:7849726-7849748 CCGGGAAGCAGGGCCGTAGGAGG - Intergenic
927573619 2:24182042-24182064 CAGGGATTATGGGACGTGGGAGG + Intronic
927964743 2:27262143-27262165 CCGGGACAGCGGGCCGGGGGTGG - Intronic
929539999 2:42811719-42811741 CCAGGACGAGGGGAAGTGGGCGG - Intergenic
934552839 2:95272629-95272651 TCGGGAGGAAGGGCTGTGGGAGG + Intergenic
934882332 2:97995382-97995404 CCGGGAGGAAGGGCCGCGGCCGG - Intronic
936073667 2:109387872-109387894 GCGGGTGGATGGGCCGGGGGAGG - Intronic
936083789 2:109452944-109452966 CCGGGAGGCTGGTCCCTGGGAGG + Intronic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
942681423 2:178480838-178480860 CCGGGAGGATGCGCGGTGTGGGG + Exonic
943855567 2:192785395-192785417 ACAGGAGGATGGGCTGTGGGGGG - Intergenic
946232703 2:218302420-218302442 CAGAGGGGATGGGCCGTGGGGGG + Intronic
946418528 2:219552371-219552393 CCGGGACTAGGGGCTGGGGGCGG + Intronic
947188222 2:227472941-227472963 CCGGGGCGCCGGGCTGTGGGGGG + Intronic
1170549978 20:17468442-17468464 GCAGGACGCTGGCCCGTGGGAGG - Intronic
1170549989 20:17468496-17468518 GCAGGACGCTGGCCCGTGGGAGG - Intronic
1171383273 20:24749638-24749660 CCTGGGTGATGGCCCGTGGGAGG + Intergenic
1174204336 20:48828005-48828027 CCGGGCGGCTGGGCCGGGGGCGG + Intergenic
1181147340 22:20858484-20858506 GCGGGACGAGGGTCTGTGGGAGG - Intronic
1181670996 22:24425343-24425365 CCGGGATGTTGGGCGGGGGGGGG - Intronic
1184470293 22:44692241-44692263 CCGGGAGGAGGAGCCCTGGGTGG - Intronic
1184470340 22:44692358-44692380 CCGGGAGGAGGAGCCCTGGGAGG - Intronic
1184470420 22:44692562-44692584 CCGGGAGGAGGAGCCCTGGGTGG - Intronic
1184683411 22:46085137-46085159 CCGGGAAGGCGGGCCGAGGGAGG + Intronic
1184955923 22:47885826-47885848 CCGGGACAATGGGAAGTGGATGG + Intergenic
1185070864 22:48654915-48654937 CTGGGAGGAGGGGCCGTGGTGGG + Intronic
956675120 3:71725532-71725554 CCGCGCGGAGGGGCCGTGGGAGG + Intronic
966182014 3:177197025-177197047 CGGGGGCGCTGGGCCGCGGGGGG - Intronic
967969160 3:194986478-194986500 CTGGGACGGGGAGCCGTGGGAGG - Intergenic
968674804 4:1871596-1871618 CCGGGAGGCCGGGCTGTGGGAGG + Intronic
976246747 4:83012654-83012676 CCGGGCCGGTGGGCCTTGGCGGG - Intronic
984758479 4:183344657-183344679 AAGGGGCGATGGGCCCTGGGCGG - Intergenic
987332149 5:16866880-16866902 CCGGGAAGAGCGGCTGTGGGTGG - Intronic
991799858 5:70349433-70349455 CCGGGAGCATGGGACGTGGTAGG + Intergenic
991828739 5:70660605-70660627 CCGGGAGCATGGGACGTGGTAGG - Intergenic
995064170 5:107841426-107841448 CCTGCAGGATGGTCCGTGGGGGG - Intergenic
1002442771 5:179272934-179272956 CCGAGAGGAGGGGACGTGGGTGG + Exonic
1002709219 5:181184167-181184189 CCGGGGCGAGGGACCCTGGGCGG + Intergenic
1003154868 6:3583912-3583934 CTGGGATGAAGGGCAGTGGGAGG - Intergenic
1004216927 6:13711743-13711765 CGGGGACGAGGCGCCGAGGGCGG + Intergenic
1019732166 7:2634362-2634384 CTGGGAGAATGGGCAGTGGGTGG + Intronic
1022410276 7:30134856-30134878 CCGGGACGCGGGGCGGCGGGAGG - Exonic
1025089757 7:56052128-56052150 CCGGGACGGTGGGGCTTAGGAGG - Intronic
1026010142 7:66629505-66629527 GAGGGAGGGTGGGCCGTGGGAGG + Intronic
1027141634 7:75661801-75661823 GGGGGAGGATGGGCAGTGGGAGG + Intronic
1030138976 7:106285497-106285519 ACGGGAAGATGGGCAGTAGGAGG - Intronic
1037645285 8:20787371-20787393 CCTGGAGGATGGGGAGTGGGTGG - Intergenic
1046681162 8:117171760-117171782 CTGGGAGGATAGGCAGTGGGAGG + Intronic
1048484322 8:134832609-134832631 CCGTGAGGAGGAGCCGTGGGCGG + Intergenic
1055945767 9:81689645-81689667 CCGGGAGGTTGGGGGGTGGGGGG + Intergenic
1057503763 9:95616187-95616209 CAGGCACCATGGGCCCTGGGAGG + Intergenic
1186511198 X:10130897-10130919 CCAGGGCGAGTGGCCGTGGGAGG + Intronic
1190526270 X:51332523-51332545 CCGGGGCGAGGGGCCAGGGGCGG - Intronic
1195942418 X:110176981-110177003 CGGGCAGGATGGGCAGTGGGGGG - Exonic