ID: 1122264099

View in Genome Browser
Species Human (GRCh38)
Location 14:100538670-100538692
Sequence GGCCGCGGTGGCGGCCCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 632}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122264099_1122264111 17 Left 1122264099 14:100538670-100538692 CCAGCGGGGCCGCCACCGCGGCC 0: 1
1: 0
2: 7
3: 56
4: 632
Right 1122264111 14:100538710-100538732 AGGGCTGCCCTCGTAGGTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1122264099_1122264109 11 Left 1122264099 14:100538670-100538692 CCAGCGGGGCCGCCACCGCGGCC 0: 1
1: 0
2: 7
3: 56
4: 632
Right 1122264109 14:100538704-100538726 AAAGCGAGGGCTGCCCTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1122264099_1122264113 21 Left 1122264099 14:100538670-100538692 CCAGCGGGGCCGCCACCGCGGCC 0: 1
1: 0
2: 7
3: 56
4: 632
Right 1122264113 14:100538714-100538736 CTGCCCTCGTAGGTGGTGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 150
1122264099_1122264115 24 Left 1122264099 14:100538670-100538692 CCAGCGGGGCCGCCACCGCGGCC 0: 1
1: 0
2: 7
3: 56
4: 632
Right 1122264115 14:100538717-100538739 CCCTCGTAGGTGGTGGCGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 160
1122264099_1122264107 -2 Left 1122264099 14:100538670-100538692 CCAGCGGGGCCGCCACCGCGGCC 0: 1
1: 0
2: 7
3: 56
4: 632
Right 1122264107 14:100538691-100538713 CCGTGGCCTTGGCAAAGCGAGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1122264099_1122264112 20 Left 1122264099 14:100538670-100538692 CCAGCGGGGCCGCCACCGCGGCC 0: 1
1: 0
2: 7
3: 56
4: 632
Right 1122264112 14:100538713-100538735 GCTGCCCTCGTAGGTGGTGGCGG 0: 1
1: 0
2: 2
3: 19
4: 185
1122264099_1122264110 14 Left 1122264099 14:100538670-100538692 CCAGCGGGGCCGCCACCGCGGCC 0: 1
1: 0
2: 7
3: 56
4: 632
Right 1122264110 14:100538707-100538729 GCGAGGGCTGCCCTCGTAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 75
1122264099_1122264105 -3 Left 1122264099 14:100538670-100538692 CCAGCGGGGCCGCCACCGCGGCC 0: 1
1: 0
2: 7
3: 56
4: 632
Right 1122264105 14:100538690-100538712 GCCGTGGCCTTGGCAAAGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122264099 Original CRISPR GGCCGCGGTGGCGGCCCCGC TGG (reversed) Exonic