ID: 1122264855

View in Genome Browser
Species Human (GRCh38)
Location 14:100541771-100541793
Sequence CCCTGGGCTGTCCATGTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 283}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122264837_1122264855 25 Left 1122264837 14:100541723-100541745 CCGGTGCCATGCCCATAGCCCCT 0: 1
1: 0
2: 0
3: 20
4: 203
Right 1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 283
1122264842_1122264855 14 Left 1122264842 14:100541734-100541756 CCCATAGCCCCTGGGGCACCTGG 0: 1
1: 0
2: 3
3: 34
4: 230
Right 1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 283
1122264847_1122264855 5 Left 1122264847 14:100541743-100541765 CCTGGGGCACCTGGCTGAGTACC 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 283
1122264844_1122264855 13 Left 1122264844 14:100541735-100541757 CCATAGCCCCTGGGGCACCTGGC 0: 1
1: 0
2: 4
3: 24
4: 333
Right 1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 283
1122264846_1122264855 6 Left 1122264846 14:100541742-100541764 CCCTGGGGCACCTGGCTGAGTAC 0: 1
1: 0
2: 1
3: 21
4: 162
Right 1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 283
1122264845_1122264855 7 Left 1122264845 14:100541741-100541763 CCCCTGGGGCACCTGGCTGAGTA 0: 1
1: 0
2: 3
3: 14
4: 175
Right 1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 283
1122264841_1122264855 19 Left 1122264841 14:100541729-100541751 CCATGCCCATAGCCCCTGGGGCA 0: 1
1: 0
2: 2
3: 27
4: 288
Right 1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 283
1122264848_1122264855 -4 Left 1122264848 14:100541752-100541774 CCTGGCTGAGTACCCAAGCCCCT 0: 1
1: 0
2: 0
3: 7
4: 153
Right 1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122264855 Original CRISPR CCCTGGGCTGTCCATGTCTG AGG Intronic
900370222 1:2328930-2328952 CCCTGGGCTGCAGATGCCTGCGG - Intronic
900509103 1:3050027-3050049 GCCTGGGCTGTTCTTGGCTGTGG - Intergenic
900681611 1:3919862-3919884 CCCTGGGCTGTCTTGGTCTCTGG + Intergenic
901005499 1:6169882-6169904 GCCTGGGGTGTCCATGGCAGAGG - Intronic
901046433 1:6398921-6398943 TCCTGGGATGGCCATTTCTGAGG - Intergenic
901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG + Intronic
902263315 1:15243582-15243604 CTCTGGGCTGTTCTTGCCTGGGG - Intergenic
902624703 1:17669900-17669922 CCCTGGGCTTTCCCTGTCCCTGG - Intronic
902874742 1:19334040-19334062 CCCAGGGCTGTCCCAGGCTGGGG - Intergenic
903362097 1:22783301-22783323 CCCTCTCCTATCCATGTCTGGGG - Intronic
903573252 1:24321879-24321901 CCCGGGGCTGCCCAGGGCTGCGG - Intronic
903780090 1:25815430-25815452 GCCTTGACTGTCCTTGTCTGAGG - Intronic
905389382 1:37626447-37626469 CCCGGGGCTGTCCATGCCCTCGG + Intronic
905868802 1:41391389-41391411 CGCTGGGCAGTCCAGGTCTCTGG + Intergenic
905883826 1:41481214-41481236 CCCTGGGCAGTCCATCACTTGGG - Intronic
907522504 1:55033375-55033397 CTCTGGGCTGTTCCAGTCTGGGG + Intergenic
907551445 1:55308472-55308494 CCCTGGGCTGGGCAGCTCTGAGG + Intergenic
908682257 1:66675336-66675358 CCCAGACCTGTCCATGACTGTGG + Intronic
911241654 1:95474380-95474402 CCCTGGACTGTCCATGGTTAAGG + Intergenic
912708766 1:111934469-111934491 ACCTGGGCCTTCTATGTCTGGGG - Intronic
914352094 1:146849181-146849203 CCCTGTGCTCTGCATCTCTGAGG + Intergenic
915516053 1:156413329-156413351 GCCTGGGATGTCCTTGGCTGTGG + Intronic
917969697 1:180198754-180198776 CCTTGGGCTGGCCCTGGCTGGGG + Exonic
918252576 1:182716532-182716554 CACTTGGCCTTCCATGTCTGGGG - Intergenic
920671105 1:208004215-208004237 CACTGTGCTGTCCATCTCTCAGG - Intergenic
922158576 1:223060487-223060509 CCCTGTTCTGTCCTTGGCTGGGG - Intergenic
922679839 1:227584499-227584521 CTTTTGGCTGTCCATGTGTGAGG + Intronic
922696508 1:227733625-227733647 AGCTGGTCTGTCAATGTCTGTGG - Exonic
924703957 1:246482881-246482903 CCTTGGTCTGCCCTTGTCTGTGG - Intronic
1063623051 10:7666847-7666869 CCTGGGGCTGTCCCTGTGTGTGG - Exonic
1065176669 10:23082778-23082800 TCCTGGGCTCTTCATGTCTGAGG - Intergenic
1066500262 10:35986703-35986725 CCCAGAGCTGTCCATGACTGGGG - Intergenic
1066628154 10:37430976-37430998 CCCAGAGCTGTCCATGGCTGGGG - Intergenic
1067375050 10:45720161-45720183 CTCAAGTCTGTCCATGTCTGCGG + Intergenic
1067476279 10:46568922-46568944 CCCTGGGCTGCTGATCTCTGGGG + Intergenic
1067618458 10:47772858-47772880 CCCTGGGCTGCTGATCTCTGGGG - Intergenic
1067882868 10:50061802-50061824 CTCAAGTCTGTCCATGTCTGCGG + Intergenic
1068134838 10:52941158-52941180 CCCTGAGCCGTGCATGCCTGCGG - Intergenic
1070146026 10:73773746-73773768 CACTGGGCAGTCCATGTGTGAGG - Exonic
1070969494 10:80551887-80551909 CCCTGGACTCTGGATGTCTGAGG + Intronic
1071440017 10:85681827-85681849 CACTGCGCTGAGCATGTCTGGGG - Intronic
1072642462 10:97222419-97222441 CCCTCCCCTGGCCATGTCTGGGG - Exonic
1075900772 10:126041252-126041274 CCCTGGCCTGGCCATGGCTCAGG - Intronic
1076496618 10:130901605-130901627 CCCTGGGCTGGCCTTGCCTGAGG + Intergenic
1077148911 11:1059760-1059782 CCCTGGGCTGCTCTTCTCTGAGG + Intergenic
1077186011 11:1235693-1235715 CCCTGGGCTGTGGCTGCCTGTGG + Intronic
1077248054 11:1548649-1548671 CCCTGCGCTGTCCTGGTCGGAGG + Intergenic
1077279043 11:1733710-1733732 CACTGGGCTGTCCAAGTCAAGGG + Exonic
1077516778 11:3006983-3007005 CCCTGGCTCCTCCATGTCTGAGG - Intronic
1078350295 11:10587375-10587397 CCCTGGGCTGGGCTTGTCAGAGG - Intronic
1079417354 11:20251862-20251884 GCCTGGGCTGACAATGCCTGTGG + Intergenic
1079941712 11:26688926-26688948 GCCTGGGCTGTTCTTGTTTGAGG - Intronic
1080671171 11:34379489-34379511 CACTGGGCTCTGCTTGTCTGGGG + Intergenic
1083067497 11:59940037-59940059 GCCTGGGCTGTCAATTTCTAAGG + Intergenic
1084518827 11:69650625-69650647 CCTTGGGCCGTGCATGACTGAGG - Intronic
1085392375 11:76189053-76189075 CCCAGGTCTGTCCAGCTCTGGGG - Intronic
1086107440 11:83160584-83160606 CCCTGGTTTGTGCATGTCAGAGG + Intronic
1089165886 11:116476166-116476188 CCTGGTGCTGTCCCTGTCTGTGG - Intergenic
1089383136 11:118050408-118050430 ACCTGGGCTGTGCATGACTCTGG - Intergenic
1090247071 11:125224199-125224221 CCCTGGCCTCTCCGTGCCTGGGG + Intronic
1091194093 11:133717443-133717465 GCTTGGGCTGTCGGTGTCTGTGG - Intergenic
1091763430 12:3102869-3102891 CACTGGGATGTCCCTCTCTGGGG - Intronic
1093121801 12:15279696-15279718 CCCTGGGTGTTCCATGTATGTGG - Intronic
1094219331 12:27975416-27975438 CCCTGGCCTGGCCCTGTCCGGGG + Intergenic
1095599940 12:44002619-44002641 CCCTGGGTTGTCCAGATCTAAGG + Intronic
1097040354 12:56152610-56152632 CCCTGCGGGGTCCGTGTCTGGGG - Exonic
1097261934 12:57725366-57725388 CCTTGGGCTGTCTGTGTCAGTGG - Intronic
1100990087 12:100242632-100242654 CCCAGGGTTGTCCATTACTGGGG + Intronic
1101655041 12:106712624-106712646 CCCTGTGCTGTCCATGCCAGGGG - Intronic
1102793872 12:115671982-115672004 CCCTGGACTCTCCAGGGCTGTGG - Intergenic
1103322386 12:120099754-120099776 CCCTGGGCTCTGCATGTTTGGGG - Intronic
1104773974 12:131381714-131381736 CCCTGGGTCTTTCATGTCTGCGG - Intergenic
1109152321 13:58860159-58860181 CCCTGAGCTGTGCGTGCCTGCGG + Intergenic
1109331744 13:60939661-60939683 CCCTTGGCTCTCCGTCTCTGTGG - Intergenic
1112996254 13:105578146-105578168 CCCGTGGCTCTCCAGGTCTGAGG + Intergenic
1113469088 13:110531697-110531719 CCCAGGGCTGCCCATGTCCCGGG + Intronic
1113484791 13:110645978-110646000 CCCTGAGCTGTCCATTCCCGTGG + Exonic
1113542330 13:111118550-111118572 GGCTGGGCTGCCCATGTCTTCGG + Intronic
1114604639 14:23986815-23986837 CCCAGGGCTCTCCATCTGTGTGG - Intronic
1118760220 14:68876463-68876485 CCCTGGGCTGGAGATGGCTGTGG + Intronic
1119068865 14:71560293-71560315 CCCTGGACTGTTGATTTCTGGGG - Intronic
1119424803 14:74528373-74528395 CCCTGGGCATCCCATCTCTGTGG - Intronic
1119668753 14:76502736-76502758 CCCTGAGCTGTTCACGTATGTGG - Intergenic
1120176721 14:81302120-81302142 CTCTGGACTGTGCCTGTCTGTGG + Intronic
1122264855 14:100541771-100541793 CCCTGGGCTGTCCATGTCTGAGG + Intronic
1122518632 14:102326803-102326825 CCTGGGGCTGTCCATGCCAGCGG + Exonic
1122671060 14:103372747-103372769 CCCTGGCCAGCTCATGTCTGAGG + Intergenic
1124649673 15:31465472-31465494 TCCTGGGCAGTCCCTGCCTGGGG + Intergenic
1128346898 15:66859762-66859784 ACTTGGGCTGTGCATGTCAGTGG - Intergenic
1129101707 15:73271003-73271025 CCCTGGGCTTTCCTAGTCTAGGG + Intronic
1129463697 15:75712403-75712425 CCCTAGGCAATCCATGCCTGGGG + Intronic
1130092583 15:80833361-80833383 CTCTAGGCTTTCCATATCTGAGG + Intronic
1130893210 15:88150607-88150629 CACTGGGTTGTCTGTGTCTGTGG - Intronic
1132565951 16:623066-623088 TCCTGGGATGGCCATGTCTGAGG - Intronic
1132571750 16:647300-647322 GCCTAGGCTGGCCAAGTCTGGGG + Intronic
1132791250 16:1689931-1689953 CCCTGGGAGGTCCATGGCTGAGG + Intronic
1132888914 16:2194855-2194877 CCCTGGGCCGTCCAAGACTGCGG + Intronic
1136228776 16:28875330-28875352 CCCTGGGCTTCCCAGCTCTGGGG + Intergenic
1138105415 16:54285064-54285086 GCCTGAGCTGTCCCTGGCTGGGG - Exonic
1138581873 16:57946743-57946765 AACTGGGCTGTCAATGGCTGGGG - Intronic
1138944225 16:61828329-61828351 CCCAGGGCTGCCCCTGTCTATGG + Intronic
1139981936 16:70866351-70866373 CCCTGTGCTCTGCATCTCTGAGG - Intronic
1140887358 16:79256533-79256555 TCCTGGTGTGTCCTTGTCTGTGG - Intergenic
1141006375 16:80356663-80356685 CCCTTGGTTCTACATGTCTGAGG + Intergenic
1142251929 16:88995989-88996011 CCCTGGGCTCCCCGGGTCTGCGG + Intergenic
1142383799 16:89749585-89749607 CCCAAGCCTGTCCATTTCTGTGG - Intronic
1142682459 17:1558253-1558275 GCTGGGGCTGTGCATGTCTGGGG - Intronic
1142689833 17:1598831-1598853 CCCTGCCCTGTCCAGGCCTGAGG - Intronic
1142720019 17:1769856-1769878 CCCTGTGCTGTCGGGGTCTGGGG - Exonic
1143334036 17:6159131-6159153 CCCTGAGCTTCCCATCTCTGAGG - Intergenic
1143742730 17:8965930-8965952 CCCTGGCCGGTCCATGGCAGTGG + Intergenic
1144849675 17:18237759-18237781 CCCTGTGCTGGCCAGGTGTGTGG + Exonic
1146382433 17:32341130-32341152 CTCTGGCCTGTACATGTCAGTGG - Intronic
1147164013 17:38583975-38583997 CCCTGGGCTGCTCAGGTCCGAGG - Intronic
1147166694 17:38597140-38597162 CCCTGGGATGTCGATGTTTTAGG - Intronic
1147420859 17:40321593-40321615 CCATGGGCTGTCCATCCCTCTGG + Intronic
1147585858 17:41653749-41653771 CCATGGGGTGCCCATCTCTGGGG - Intergenic
1148460527 17:47836871-47836893 ACCTGGGGTGCCCATGGCTGGGG + Exonic
1148779336 17:50112703-50112725 CCCTGGGGTCTCCCTTTCTGGGG + Exonic
1150633815 17:66898771-66898793 CCCTGGGCAGTCCATATCCAGGG + Intergenic
1152322764 17:79617412-79617434 CCCTGGGGTGTCCGTGGGTGTGG - Intergenic
1152933506 17:83122662-83122684 CTCTGGGCCGGCCATCTCTGAGG - Intergenic
1154379636 18:13837560-13837582 CCGAGGCCTGTCCATGTTTGGGG + Intergenic
1154388130 18:13913879-13913901 ACCTGCCCTGACCATGTCTGAGG + Intronic
1156341729 18:36215510-36215532 TCCTAGGCTGGTCATGTCTGTGG + Exonic
1157307530 18:46528169-46528191 CCTGTGGCTGTGCATGTCTGGGG - Intronic
1157718397 18:49905208-49905230 CCCTGGGATCTCCAAGCCTGGGG - Intronic
1158874893 18:61724002-61724024 CCCTGGTTTGCCCAAGTCTGAGG + Intergenic
1160923853 19:1533677-1533699 GCCTGGGCTGTCCAGGACAGAGG + Intronic
1160930910 19:1568944-1568966 CCCTGGGGTGTGCATGATTGTGG - Intergenic
1161375206 19:3936461-3936483 CCGGGGCCTGTCCATGTCTCAGG - Intronic
1162127553 19:8507469-8507491 CCCAGAGCTGTCCATCTTTGAGG + Intergenic
1162693894 19:12456710-12456732 GCCTGGGCTGTTGATGTCTCTGG - Intronic
1162733545 19:12733356-12733378 CTCTGAGCTTGCCATGTCTGTGG - Intronic
1162951225 19:14073102-14073124 CCCCGGGCTGTCCACAGCTGCGG + Exonic
1162959405 19:14117354-14117376 CCCCGGCCTGTCCAAGGCTGGGG - Intronic
1163497416 19:17654987-17655009 CCCTGGGCTGTGTGTGTATGTGG + Intronic
1163566035 19:18051962-18051984 CCCTGGGCTGACCCTGCCAGCGG - Intergenic
1163575004 19:18105706-18105728 TCTTGGGCAGCCCATGTCTGAGG + Intronic
1164386221 19:27772883-27772905 CTCTAGCCTTTCCATGTCTGAGG + Intergenic
1164520655 19:28976735-28976757 CACTGGGCTTTCGAGGTCTGGGG - Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165231705 19:34391318-34391340 TCTAGGACTGTCCATGTCTGAGG + Intronic
1165231914 19:34392768-34392790 CCTGGGTCTGTCCATATCTGAGG + Intronic
1165232253 19:34394477-34394499 CCTGGGTCTGTCCATGTCTGAGG + Intronic
1165893807 19:39130020-39130042 CTCTGGGCTGTCACCGTCTGGGG - Intronic
1166322188 19:42025367-42025389 CCCTGGTCGCTCCATGGCTGGGG + Intronic
1166645777 19:44530697-44530719 CTCTGGGTTGTCACTGTCTGGGG - Intergenic
1166720063 19:44991455-44991477 CCCTAGGTTGTCCCTGTCTGGGG - Intronic
1167124360 19:47539103-47539125 CTCTGGGTTGTCACTGTCTGGGG + Intronic
1167299920 19:48672398-48672420 CCCTGGGCTGGGCATCTCTGGGG + Intronic
1167672505 19:50861578-50861600 CCCTAGGCTGTGAATCTCTGTGG - Intronic
1167762594 19:51458760-51458782 CCCGGGGCTGTCACTGTTTGTGG + Intergenic
925154806 2:1640780-1640802 CCCAGGGCTGTGCAGGTCTGGGG + Intronic
925646937 2:6045189-6045211 CCCTGGGGGCTCCATCTCTGAGG - Intergenic
926207388 2:10843567-10843589 CCCTGATCTGTCCATGTATGCGG - Intergenic
926208829 2:10853782-10853804 CCCAGGGCTGTGGGTGTCTGTGG + Intronic
926580169 2:14626121-14626143 TCCTGGCCTTTCCATGTCTGTGG + Intergenic
927184430 2:20472261-20472283 CTCTGGGCTTTCCAAGTCAGTGG - Intergenic
927417937 2:22898571-22898593 CCATGGGGTGTCCAGGTCTTTGG + Intergenic
929820237 2:45267424-45267446 ATCTGGGCTGGCCTTGTCTGGGG - Intergenic
930092641 2:47542312-47542334 CCCTGGGCTGTGCATGTGCCAGG - Intronic
931268585 2:60682276-60682298 CTATTGGCTGTCCATATCTGTGG - Intergenic
933771167 2:85745066-85745088 CCCTGGGGCATCCAGGTCTGTGG + Intergenic
934514955 2:94980824-94980846 CCCTGGGCAGGGCAGGTCTGTGG + Intergenic
934947606 2:98553144-98553166 CCTTGGTCTGTCCAGCTCTGCGG - Intronic
935411956 2:102773325-102773347 CCCAGCCCTGTCCATGTCTTAGG - Intronic
935827103 2:106962750-106962772 CCCTGGGCTGCCCAGGCATGGGG + Intergenic
936526541 2:113245431-113245453 CCCTGCCCTGTCCAAGCCTGAGG + Intronic
937091440 2:119209078-119209100 TCCTGAGCTGTGCATGCCTGTGG - Intergenic
940316842 2:152335596-152335618 CCCTGCGTTGCCCATGTCGGCGG - Exonic
941528795 2:166638524-166638546 ATCTGGGCAGTCCATGTATGAGG + Intergenic
947768956 2:232655778-232655800 CCCTGTCCTGTCCTTGTGTGGGG + Intronic
948423428 2:237874217-237874239 CCCTGGGCTGTCCAGAGCAGCGG - Intronic
948922788 2:241073555-241073577 CCCTGGCCTGTTCCCGTCTGTGG - Intronic
1170789886 20:19498975-19498997 CCCTGGCCTCTCCAAGTCTGTGG - Intronic
1171393459 20:24816056-24816078 CCCTGGGCCGTACATGTGGGTGG - Intergenic
1173673188 20:44811749-44811771 CTCTGGGCTGTCTCTTTCTGAGG - Intergenic
1173984096 20:47247737-47247759 CCCCGGGCTGTTCATGGCTCTGG - Intronic
1174564925 20:51457738-51457760 ACCTGGGCTGGGCAGGTCTGGGG - Intronic
1175404835 20:58719306-58719328 GCCTGGGCTGTACATGTGCGCGG - Intergenic
1175849989 20:62085119-62085141 CCCTGGGCGCTCCTTGGCTGGGG - Intergenic
1175913542 20:62415566-62415588 CCCTGCCCTTACCATGTCTGGGG + Exonic
1176233917 20:64045433-64045455 CCCCAGGCTGTCTGTGTCTGTGG + Intronic
1176652843 21:9565872-9565894 CCCTGGGCTGTCAGTGTGTTAGG + Intergenic
1178605682 21:34034742-34034764 CCCTAGGTTGTCCAGGTCTTTGG - Intergenic
1178694407 21:34780645-34780667 CCCTGGTGTGTCCATCTCTTTGG + Intergenic
1179376530 21:40854262-40854284 CACGGGGCTTTCAATGTCTGGGG + Intergenic
1179719336 21:43306476-43306498 CCCCGGGCTGTGCCTGCCTGGGG - Intergenic
1179794661 21:43776077-43776099 CCCTGGGCTGGCCCGGGCTGTGG - Intronic
1181172963 22:21020488-21020510 GGCTGGGCTGTCCATGTGGGTGG - Intronic
1181566586 22:23742517-23742539 GCCTGGGCTGTGTATGCCTGCGG - Exonic
1182651766 22:31857528-31857550 TCGTGGGCTGTCCATGTAGGTGG - Exonic
1183638631 22:39080144-39080166 ACCTGCACTGTCCATGTCGGGGG - Intronic
1184489418 22:44800537-44800559 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489430 22:44800570-44800592 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489442 22:44800603-44800625 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489454 22:44800636-44800658 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489466 22:44800669-44800691 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489583 22:44801057-44801079 CCCGCAGCTGTCCATGTGTGAGG + Intronic
1184489593 22:44801090-44801112 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489602 22:44801122-44801144 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489611 22:44801154-44801176 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489623 22:44801187-44801209 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489632 22:44801219-44801241 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489671 22:44801381-44801403 CCCGCAGCTGTCCATGTGTGGGG + Intronic
1184489683 22:44801414-44801436 CCCACAGCTGTCCATGTGTGGGG + Intronic
1184850433 22:47116621-47116643 CCCTGGGCCCTGCATCTCTGTGG + Intronic
1184889064 22:47368515-47368537 CCCCGGGCTGGCCCTGTCAGAGG + Intergenic
1185374400 22:50475325-50475347 CCCTGGGCCGTCCCAATCTGGGG + Intergenic
1185411985 22:50687488-50687510 CCCTGGTTTGTGCATGTGTGGGG + Intergenic
950790027 3:15464167-15464189 CCCTCTCCTGTCCATGTCTAGGG - Intronic
950967874 3:17158850-17158872 CCCAGGGATGGCCAGGTCTGTGG + Intronic
951289205 3:20855054-20855076 CTCTGGGGTGACAATGTCTGGGG - Intergenic
951289240 3:20855237-20855259 CTCTGGGGTGACAATGTCTGTGG - Intergenic
951289295 3:20855558-20855580 CTCTGGGGTGACCATGTCTCTGG - Intergenic
951963693 3:28357394-28357416 CCGTGGGCTGCCCATGTATTTGG + Intronic
952965652 3:38619504-38619526 CTCAGGGCTGCTCATGTCTGGGG + Intronic
953004707 3:38967534-38967556 CCCTGGGCTATGCTTGTTTGTGG + Intergenic
953884695 3:46708617-46708639 CCCTGGGCTCTCCCTGGCTAGGG - Intronic
954082058 3:48218206-48218228 CCCTTGGGAGTCCCTGTCTGAGG + Intergenic
954616197 3:51969866-51969888 CCCTGGGCTTTCCTCATCTGGGG - Intronic
954640000 3:52092183-52092205 CCCTGGCCTGCCCCTGTGTGGGG - Intronic
963157638 3:142116458-142116480 CCCTGGGCATTCCTTGGCTGTGG - Intronic
965320569 3:167248118-167248140 CCCTGAGCTGTGTGTGTCTGTGG - Intronic
968185150 3:196627962-196627984 CCCTGGCATGACCATGGCTGTGG - Intergenic
969130960 4:4990906-4990928 CCCTGATTTGGCCATGTCTGGGG + Intergenic
969608908 4:8216335-8216357 CGCTGTGCTGAGCATGTCTGGGG + Intronic
970157187 4:13153228-13153250 TCCTGGGCTGGCATTGTCTGCGG + Intergenic
970211627 4:13715957-13715979 CCCAGGGATGTCCAGCTCTGCGG - Intergenic
973961314 4:56112591-56112613 CCCTCGGCTCCCCCTGTCTGAGG + Intergenic
976905874 4:90235207-90235229 CCTTGGGCTCTCCATGTCCCAGG + Intronic
981234908 4:142404294-142404316 CCCTGAGCTAGCCAGGTCTGGGG + Intronic
985434403 4:189915212-189915234 CCCAGGGCTGCCCATGCCCGTGG - Intergenic
985511341 5:315817-315839 CCCTGGGATCCCCATGACTGAGG - Intronic
985530727 5:432686-432708 CTCTGGTCTGTGCATTTCTGAGG + Intronic
985578682 5:685462-685484 CCCTGTCCTGCCCAGGTCTGAGG - Intronic
986456688 5:7927242-7927264 CCCTGGGCTGCTCCTGTCTGTGG + Intergenic
987488873 5:18552111-18552133 CTCTGGGCTGGCCAAGGCTGGGG - Intergenic
995996633 5:118308326-118308348 CCGTGGGTTCTACATGTCTGAGG + Intergenic
997349660 5:133221490-133221512 CCCAGGGCTGTAGCTGTCTGGGG + Intronic
997637916 5:135428279-135428301 CCCCAGGCTGCCCATGGCTGGGG + Intergenic
1002107360 5:176886820-176886842 CCCTGGGCCTACCCTGTCTGGGG + Intronic
1002305922 5:178282830-178282852 CCCTTGGCAGTCTATCTCTGGGG + Intronic
1002570746 5:180138011-180138033 GCCTGGGGTGACCATGTCGGAGG + Exonic
1002794733 6:463348-463370 CCCTGAGCTGTCTGTGTCAGGGG - Intergenic
1003074101 6:2968612-2968634 CCCTGCGCTGCCTATCTCTGGGG + Intronic
1003203073 6:3980976-3980998 ACCTGAGTTGCCCATGTCTGAGG + Intergenic
1004015027 6:11724268-11724290 CCCTTAGCTCTCCAAGTCTGCGG + Intronic
1004134319 6:12951716-12951738 CCATGGCCTGTGCAAGTCTGAGG + Intronic
1004718713 6:18245345-18245367 CCCTAGAATGTCCCTGTCTGTGG + Intronic
1006313806 6:33278865-33278887 CTCTGGGCTCTCCAGGTTTGTGG - Intronic
1009687102 6:66975974-66975996 CTCTGGACTGTCCATGTGTTTGG - Intergenic
1012443981 6:99289951-99289973 TCCTGGGCTGTCCATATGTGTGG - Intronic
1016804116 6:148195776-148195798 CCCTGGGCTGTGCCTGTCACTGG - Intergenic
1017407892 6:154139588-154139610 CCCTGGGCTGCACAGGTCAGGGG - Intronic
1018171389 6:161146045-161146067 CCCTGTCCTGTTCCTGTCTGTGG - Intronic
1018450934 6:163906765-163906787 CTCTGGGCTGGGCAAGTCTGGGG + Intergenic
1019134051 6:169897241-169897263 CCCTGGGCTGCCCAGGTGGGTGG - Intergenic
1019354054 7:569838-569860 CCCTGGGGTGGCCCTGTCCGTGG - Intronic
1019414706 7:921952-921974 CCCTGGGATGCCCTTGTGTGCGG - Intronic
1019912198 7:4107282-4107304 GCCTGGTCTGTGCATGTGTGAGG - Intronic
1020226801 7:6286691-6286713 CCCTGGGCAGTGCATTTGTGTGG - Intergenic
1023296702 7:38722364-38722386 CCCTGGGCAGCCCAGTTCTGTGG + Intergenic
1024202550 7:47121731-47121753 CCCTGGGCTGTCATTGCCTTAGG + Intergenic
1024678422 7:51658900-51658922 CCCTGCGCCGTCCGTGTCAGAGG - Intergenic
1025158174 7:56629243-56629265 CCCTGGTCTGTCCCATTCTGTGG - Intergenic
1029364166 7:100106650-100106672 CCCTGGGACGTCCATCTGTGAGG - Exonic
1029639801 7:101814051-101814073 CCCTGGCATGTCTATTTCTGCGG - Intergenic
1034931445 7:155166953-155166975 CCCTGTGCTCTGCATGTTTGAGG + Intergenic
1035466069 7:159078690-159078712 CCTTGGGCTATTCATGGCTGAGG + Intronic
1035764921 8:2098358-2098380 CCCCGGGCTGCCCATGTCCCTGG - Intronic
1037921476 8:22809333-22809355 TCCAGGGCTGTGCATGGCTGAGG + Intronic
1039270374 8:35874119-35874141 CACTGGGCTGTGTAGGTCTGTGG + Intergenic
1040956782 8:52987977-52987999 CCCTGTCCTCTCCATCTCTGAGG - Intergenic
1047217251 8:122886423-122886445 CCCTGTGCTGTCCAGTTCTATGG - Intronic
1047512991 8:125529638-125529660 CCCAGAGCTGGCAATGTCTGGGG - Intergenic
1053174046 9:35909707-35909729 CCCTGCCCTGTCCATGACCGTGG - Intergenic
1055542408 9:77325304-77325326 CCATGGGCTGTACCGGTCTGTGG - Intronic
1056939280 9:90941414-90941436 CCATGGGTTGTCCATGGGTGTGG - Intergenic
1056969179 9:91188101-91188123 CCCAGGGCTGGGCAGGTCTGGGG + Intergenic
1057188461 9:93072331-93072353 CCCTGGCCTCTGCATGACTGAGG - Intronic
1057481162 9:95446881-95446903 CCCTTGGCTGCCCTTGTCAGTGG + Intronic
1058800822 9:108543091-108543113 CCCTGGGCTGCCGATCCCTGGGG - Intergenic
1060836021 9:126755679-126755701 CCCTGGGCTGTCCCTGACACAGG - Intergenic
1060930449 9:127486455-127486477 TGCTGGCCTGTCCCTGTCTGGGG - Intronic
1062118530 9:134821920-134821942 TCCTGGGCTGTGCATGTCAGGGG - Intronic
1062279982 9:135747485-135747507 GCCTGGTCTGGCCATGTCAGGGG - Intronic
1062337668 9:136079517-136079539 CCATGGGGTGCCCATGCCTGCGG - Intronic
1062384573 9:136304061-136304083 CCCTGGGCTGGCCACAGCTGGGG + Exonic
1062686832 9:137817988-137818010 GTCTGGGCTGTGCTTGTCTGTGG + Intronic
1203630572 Un_KI270750v1:69413-69435 CCCTGGGCTGTCAGTGTGTTAGG + Intergenic
1185891803 X:3828568-3828590 CCCGGGGCTGTCCGTGCCAGCGG - Intronic
1185902030 X:3905408-3905430 CCCGGGGCTGTCCGTGCCAGCGG - Intergenic
1186245574 X:7613078-7613100 ATCTGAGCTGTCCATGCCTGAGG - Intergenic
1191253044 X:58268391-58268413 CCCTGCGCTGTCCCTGGCGGGGG - Intergenic
1192152229 X:68719452-68719474 TCCTGGGCTGACCCTGCCTGGGG - Intronic
1193759135 X:85442995-85443017 TCATGGGCTGGCCTTGTCTGTGG + Intergenic
1194255933 X:91633631-91633653 CCATGGCCTTTCCATGTCTAAGG - Intergenic
1200574662 Y:4872901-4872923 CCATGGCCTTTCCATGTCTAAGG - Intergenic
1200886621 Y:8278212-8278234 CCCTGGGCAACCCTTGTCTGAGG + Intergenic
1200985920 Y:9303587-9303609 ACCCTGGCTGCCCATGTCTGTGG + Intergenic
1202124659 Y:21557308-21557330 ACCCTGGCTGCCCATGTCTGTGG - Intergenic
1202154349 Y:21872072-21872094 ACCCTGGCTGCCCATGTCTGTGG + Intergenic