ID: 1122265570

View in Genome Browser
Species Human (GRCh38)
Location 14:100545127-100545149
Sequence GGCCGCACAGCCTGCTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 224}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122265564_1122265570 -5 Left 1122265564 14:100545109-100545131 CCCTCCCACGACCCTTATGGCCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1122265570 14:100545127-100545149 GGCCGCACAGCCTGCTGAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 224
1122265567_1122265570 -10 Left 1122265567 14:100545114-100545136 CCACGACCCTTATGGCCGCACAG 0: 1
1: 0
2: 1
3: 2
4: 41
Right 1122265570 14:100545127-100545149 GGCCGCACAGCCTGCTGAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 224
1122265566_1122265570 -9 Left 1122265566 14:100545113-100545135 CCCACGACCCTTATGGCCGCACA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1122265570 14:100545127-100545149 GGCCGCACAGCCTGCTGAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 224
1122265562_1122265570 0 Left 1122265562 14:100545104-100545126 CCTGTCCCTCCCACGACCCTTAT 0: 1
1: 0
2: 3
3: 10
4: 168
Right 1122265570 14:100545127-100545149 GGCCGCACAGCCTGCTGAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 224
1122265561_1122265570 10 Left 1122265561 14:100545094-100545116 CCATGCAAGGCCTGTCCCTCCCA 0: 1
1: 0
2: 3
3: 37
4: 361
Right 1122265570 14:100545127-100545149 GGCCGCACAGCCTGCTGAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 224
1122265565_1122265570 -6 Left 1122265565 14:100545110-100545132 CCTCCCACGACCCTTATGGCCGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1122265570 14:100545127-100545149 GGCCGCACAGCCTGCTGAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122265570 Original CRISPR GGCCGCACAGCCTGCTGAGC AGG Intronic
900099063 1:953314-953336 GGCCCCCCAGCCTCCTCAGCAGG + Intronic
900706239 1:4082116-4082138 GGCTGCCCAGCCTGTTGGGCTGG + Intergenic
901529379 1:9843721-9843743 GCCTGCAGAGCCTGCAGAGCTGG - Intergenic
903790801 1:25891724-25891746 GGGCTCACAGCCTGCTGCACTGG - Intronic
904188576 1:28725326-28725348 GGAGGCTCAGCCTGCTGAGATGG - Intergenic
905626132 1:39491593-39491615 GGCGGCACAGACGGCTGAGCCGG + Intergenic
905811779 1:40918421-40918443 GGCAGCCCATCTTGCTGAGCAGG + Intergenic
907766677 1:57419798-57419820 GGCCACACAGCTTACAGAGCTGG + Intronic
908240083 1:62181701-62181723 AGCAGCACTGCCTGCTGAGGCGG + Intergenic
909957765 1:81800983-81801005 GGCCGCCCCGCCGGCGGAGCCGG + Intronic
911618340 1:100038563-100038585 GGCCGCAGGGCCTGCAGAGGCGG - Intronic
912492139 1:110068314-110068336 GGCCGCACAGCCTACTTGGTGGG - Intronic
915267800 1:154731444-154731466 GGGCAGTCAGCCTGCTGAGCAGG - Intronic
919824630 1:201494555-201494577 GGCCCCACATCCTGCTCAGCCGG - Intronic
921152576 1:212414070-212414092 GGACGCACAGCCTGCAGCGCAGG + Exonic
921708000 1:218345945-218345967 GGCCGCAGAGGCTGCTGAGGCGG - Intergenic
922152229 1:223016453-223016475 GTGCACACAGCCTGCTGGGCTGG + Intergenic
922747184 1:228050961-228050983 GGGCACACACCCTGCTGAGGAGG - Intronic
922804490 1:228378391-228378413 GGGCGCACAGAGTGCTGCGCAGG - Exonic
923092794 1:230752656-230752678 GCTAGCACAGCCTGCTGGGCAGG + Intronic
924595335 1:245440268-245440290 GGAAGCAAAGCCTGGTGAGCGGG + Intronic
1064380750 10:14838977-14838999 GGCCGCAGAACGCGCTGAGCTGG + Intronic
1065754756 10:28920932-28920954 GGGCACACAGCCTGCTTAGGAGG - Intergenic
1067146539 10:43698265-43698287 GGCCACAGAGCCTGCAGAGATGG - Intergenic
1068509374 10:57944801-57944823 CGCCTTACTGCCTGCTGAGCTGG - Intergenic
1069744527 10:70706647-70706669 GGACACACAGCCTGGTGAGCAGG - Intronic
1070148623 10:73792142-73792164 GGCCGCACAGCTGGCTCAGTAGG - Exonic
1073065967 10:100759397-100759419 TGCCTCACAGCCTGCCGAGAGGG - Intronic
1075811202 10:125226427-125226449 GGCTGCACAGCCTCCTTGGCCGG + Intergenic
1076164786 10:128273018-128273040 GGCCACACAGCCAGCAGAGGTGG - Intergenic
1077350408 11:2090578-2090600 GGCTGCATAGCCAGATGAGCAGG - Intergenic
1077466095 11:2734435-2734457 GGCCCCGCAGCCAGCTGTGCTGG + Intronic
1080637881 11:34139482-34139504 GCCAGCCCAGCCTGGTGAGCCGG + Exonic
1080694103 11:34585895-34585917 AGCCCCACTGCCTCCTGAGCTGG + Intergenic
1082809127 11:57468000-57468022 TGCCGGGCAGGCTGCTGAGCTGG - Exonic
1083756525 11:64794682-64794704 GGCGGAGCAGCCTGGTGAGCTGG - Intronic
1083922668 11:65788884-65788906 GGCCACACTCCCTGGTGAGCTGG + Intronic
1084656469 11:70522645-70522667 GGCCGGCCAGCCCGCGGAGCTGG - Intronic
1085117737 11:73945093-73945115 GGCAGCACCGCCTGCTGTGGCGG + Intergenic
1085355570 11:75833624-75833646 GGTCTCACAGCCTTCAGAGCTGG + Intronic
1090832236 11:130427828-130427850 AGCCGCACCGCCTGCAGCGCTGG - Exonic
1091802406 12:3333021-3333043 GGCAGCACAGCATGCTGGGAAGG - Intergenic
1091980228 12:4858610-4858632 AGCCACAGTGCCTGCTGAGCAGG + Intergenic
1092196248 12:6551313-6551335 AGCCGGACAGCTGGCTGAGCTGG - Intronic
1092219835 12:6705438-6705460 GGCCGGACAGCCAGTTGAGGAGG - Intergenic
1094061535 12:26319655-26319677 GGCCGGAGAGCCTCCTGGGCTGG - Intergenic
1096040263 12:48509179-48509201 GGCAGCACTGCCTGCTGTGGTGG - Intronic
1096189840 12:49609330-49609352 GGCAGCTCAGGCTGCTGATCTGG - Intronic
1096450855 12:51739859-51739881 GGTCTCACAGCCTTCGGAGCTGG + Intronic
1098308263 12:69123015-69123037 GGCTGAGCAGCCTGCTGCGCTGG + Intergenic
1112584704 13:100708135-100708157 TGGCTCACAGCCTGCAGAGCTGG - Intergenic
1113944183 13:114034393-114034415 GGCCACACAGCCTGCTGCTGGGG - Intronic
1113944197 13:114034434-114034456 GGCCGCACAGCCTGCTGCCAGGG - Intronic
1114673776 14:24428411-24428433 GGAAGCAGAGCCTGCTGAGTGGG + Intronic
1119739363 14:77004200-77004222 GGCCTCTCTGCCTGCTGAGTTGG + Intergenic
1121676571 14:95758408-95758430 GGCAGCACAGCCTGCTGCAAGGG + Intergenic
1122265570 14:100545127-100545149 GGCCGCACAGCCTGCTGAGCAGG + Intronic
1122322141 14:100861576-100861598 GGCAGCAATGCCGGCTGAGCTGG + Intergenic
1123125951 14:105946100-105946122 GGCAGCACCACCTGCTGGGCAGG - Intergenic
1123406534 15:20022518-20022540 GGCAGCACCACCTGCTGGGCAGG - Intergenic
1123450477 15:20356765-20356787 GGGCGCTCAGCCTGCTTCGCTGG - Intergenic
1123515864 15:21029166-21029188 GGCAGCACCACCTGCTGGGCAGG - Intergenic
1125602950 15:40925594-40925616 CGGGGCACCGCCTGCTGAGCGGG + Intergenic
1128738435 15:70066742-70066764 GGCCCCAGAGCCAGATGAGCTGG + Intronic
1129840569 15:78740854-78740876 GGCCCCACAGCATGCACAGCCGG + Intergenic
1130342462 15:83011298-83011320 GGCAGCGCAGCCTACTGAGGCGG + Intronic
1130850127 15:87784680-87784702 TGCACCGCAGCCTGCTGAGCTGG + Intergenic
1132392277 15:101447712-101447734 GGACGTCCAGGCTGCTGAGCAGG - Intronic
1132764952 16:1529599-1529621 GGCAGCACAGCCTGAGGGGCTGG - Intronic
1133004094 16:2868252-2868274 GGCCGCAGAGGCTGCCGGGCAGG + Intergenic
1133046694 16:3092130-3092152 GGCTGCCCAGCCTGCTGAGCCGG - Exonic
1134684622 16:16150077-16150099 GCCCGCACAGCCTGCAGTGCTGG - Exonic
1136046375 16:27618327-27618349 CGCCTCTCAGCCTGCTGCGCCGG + Intronic
1136933439 16:34437630-34437652 GGCCGCGCTGCCTGGGGAGCGGG + Intergenic
1136971133 16:34974184-34974206 GGCCGCGCTGCCTGGGGAGCGGG - Intergenic
1137722504 16:50635719-50635741 GGCCGCACAGAGGGCGGAGCTGG + Exonic
1137821554 16:51450331-51450353 GGCCCCAAAGCATTCTGAGCAGG + Intergenic
1138093992 16:54197948-54197970 GGGCGCCCAGCCTGCTCTGCAGG + Intergenic
1138204416 16:55114472-55114494 GGCTGCACAGCCTGGTGGGTTGG - Intergenic
1138220599 16:55247138-55247160 GGCCACATAGCCTGGTGGGCAGG - Intergenic
1138351793 16:56349919-56349941 AGCCCCACAGCCTGCTGATATGG + Intronic
1138530843 16:57633578-57633600 GGCCACACAGCCAGTAGAGCTGG - Intronic
1139205531 16:65025092-65025114 GACCTCACAGCCTCCTGAGCAGG - Intronic
1141593532 16:85083942-85083964 GGACCAACAGCCTGCTGAGAGGG - Intronic
1142075102 16:88113479-88113501 GACAGGAGAGCCTGCTGAGCAGG + Intronic
1142137918 16:88460051-88460073 GGCCACACAGCCTGGGGAGTCGG - Intronic
1142261118 16:89042834-89042856 GGCCGCAGAGCCTGGAGACCTGG - Intergenic
1143775548 17:9196458-9196480 AGCCCCACCTCCTGCTGAGCAGG + Intronic
1144673643 17:17147067-17147089 GGCAGCACAGACAGCTGAGCAGG - Intronic
1145251473 17:21299060-21299082 GGCCACACAGCCAGCAGCGCAGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147725830 17:42565714-42565736 GGCTGCAGAGCCAGATGAGCGGG + Exonic
1147865974 17:43552591-43552613 GGCCACAGAGCCTGCTGGGTGGG + Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151588266 17:75025031-75025053 GGCAGCACTGCCTGCTGAAGTGG - Intergenic
1151745376 17:76009026-76009048 AGGAGCACAGCCGGCTGAGCGGG - Exonic
1152337964 17:79708572-79708594 GGGCGCTCAGCCTGCTTCGCTGG + Intergenic
1152626422 17:81389871-81389893 GGCCGGGCAGCCTCCTGACCTGG + Intergenic
1152919520 17:83058995-83059017 GGCCGCACTGACCACTGAGCAGG - Intergenic
1155017611 18:21860785-21860807 AGCTGCTCAGCATGCTGAGCTGG + Intronic
1155155954 18:23157567-23157589 GCCAGCACAGCCTGGTGAGAAGG - Intronic
1158590002 18:58771336-58771358 GGCCGCCCTGCCTGCTGCTCAGG + Intergenic
1159961800 18:74560951-74560973 GGACGTGCAGCCTGCTGACCGGG + Exonic
1160416928 18:78718094-78718116 TGCAGCAAAGCCTGCTGGGCTGG + Intergenic
1160508887 18:79442331-79442353 GGCAGCAGAGGCTGCTCAGCAGG - Intronic
1160597621 18:79988200-79988222 GGAAGCACAGCCCGCAGAGCGGG + Intronic
1160687798 19:444946-444968 GGCCACACGGCCCGCAGAGCTGG + Intronic
1160734043 19:653725-653747 TCCCGCACAGCCTGCAGAACTGG + Intronic
1160761789 19:789124-789146 AGCCGCACAGCCTGCTTACCTGG - Intergenic
1160800684 19:966690-966712 GGCCGCACAGGCAGCTGCCCTGG + Exonic
1162009507 19:7803741-7803763 GGCCTAACTGCTTGCTGAGCTGG + Intergenic
1162021350 19:7869895-7869917 GGCCGCTCAGCGTGCTGGACGGG + Exonic
1162376049 19:10305850-10305872 GGCCTCGCTGCCTGCTGAGTGGG + Exonic
1163153980 19:15430109-15430131 GGCCTCACAGCCTGCTCTCCCGG - Intronic
1165417603 19:35704415-35704437 GGCTGCCCAGCGTGCTCAGCTGG + Intergenic
1166794325 19:45417269-45417291 GGGCTCACAGTCTGATGAGCAGG + Intronic
1168623467 19:57897631-57897653 GGCAGCACTGCCTGCTGTGGCGG - Intronic
1168642202 19:58038007-58038029 GGCGGCACAGCGTCCAGAGCTGG - Exonic
925361326 2:3282568-3282590 GGCCGCACGGGCTGCTGCGCCGG + Intronic
925366877 2:3316783-3316805 GGCCTCACAGCCCCCTGACCTGG + Intronic
925390449 2:3490511-3490533 GTCCGCACAGCCTGGGGAGCGGG + Intergenic
926699691 2:15795535-15795557 GGCGGCACATCCTGTTGACCGGG + Intergenic
931201844 2:60105288-60105310 GGTTTCACAGCCTGCTGAGAAGG + Intergenic
932595596 2:73091802-73091824 GGCCGCTCAGGCTGCGGAGTAGG - Intronic
933524146 2:83415317-83415339 AGCCAGGCAGCCTGCTGAGCTGG + Intergenic
933724528 2:85418970-85418992 GGGCCCACAGCCTGCTAAGCAGG + Intronic
933724532 2:85418980-85419002 GGCCACTCTGCCTGCTTAGCAGG - Intronic
934712869 2:96527314-96527336 GGCAGCAGAGCCTGCGGGGCTGG + Intergenic
937267997 2:120629468-120629490 GGCCCCACAGGCTCCTGTGCTGG - Intergenic
938079135 2:128360010-128360032 GGCCGCCAGGCATGCTGAGCAGG - Intergenic
939247536 2:139645144-139645166 GGCAGCTCAGGCTGCTGATCTGG + Intergenic
941728515 2:168890170-168890192 GGCCTCACAGCCTGGTGGGGTGG - Intronic
947387488 2:229606168-229606190 GACCACACAGCCTACAGAGCTGG + Intronic
948161799 2:235830672-235830694 GGCCGCACACCGTCCTGGGCTGG - Intronic
948611406 2:239169496-239169518 GGCTCCACGGCCTGCTGGGCGGG - Intronic
1169317236 20:4602722-4602744 GGCAGCACTGCCAGGTGAGCTGG - Intergenic
1170466016 20:16623124-16623146 TTCCGCACAGCCGGCTGTGCAGG - Intergenic
1171394502 20:24823175-24823197 GGCCCCACAACCTGCTTACCAGG + Intergenic
1172892628 20:38277888-38277910 GGCCACACAGCATGCTGGGAGGG + Intronic
1173792374 20:45835971-45835993 GGCCTGAAAGCCAGCTGAGCTGG + Intronic
1174482505 20:50841608-50841630 GGCAGCAGGGCCTGCTTAGCTGG - Intronic
1176170788 20:63695538-63695560 GCACACACAGCCTGCTGAGAGGG - Exonic
1177198576 21:17929540-17929562 AGCCATGCAGCCTGCTGAGCTGG + Intronic
1179681117 21:43022012-43022034 TGCCACACAGCGTGCAGAGCAGG - Intronic
1181428330 22:22858414-22858436 GGTCACACATCCAGCTGAGCTGG - Intronic
1181493224 22:23273800-23273822 GTCCACCCATCCTGCTGAGCTGG + Intronic
1182491842 22:30677790-30677812 GGCAGCACTGCCTGCTGAGGCGG + Intergenic
1183653580 22:39172419-39172441 GGCTGCACAGCATGCTGTGGTGG - Intergenic
1185047792 22:48537661-48537683 GGCTGCAGTGCCTGCTGGGCTGG - Intronic
953852687 3:46478225-46478247 GGCTGCCCAGGCTGCTGAGAGGG - Intronic
956892304 3:73624723-73624745 GGCCGCACGGCGTGGTCAGCGGG + Exonic
957025193 3:75173684-75173706 AGCCTCACGGCCTGCAGAGCTGG + Intergenic
961006938 3:123411713-123411735 GTCCTCACAGCCTGGTGACCAGG + Intronic
961345179 3:126259616-126259638 GGCCCCACAGCCTGACCAGCGGG + Intergenic
962263147 3:133927630-133927652 GGCCCCACAGCCAGCCGGGCGGG - Intergenic
963811561 3:149781856-149781878 GGCAGCTCAGCTTGCTGATCTGG - Intronic
968148656 3:196320316-196320338 GGAGGCACAGCCTCTTGAGCAGG - Intronic
968472583 4:788817-788839 GGCAGCACAGCCTCCTGGGCTGG - Intronic
968631277 4:1653439-1653461 CGCCCCACAACGTGCTGAGCCGG + Intronic
969448596 4:7259908-7259930 GGCCACCCAGCCTGTTGGGCAGG + Intronic
979222268 4:118241427-118241449 GGCCACAAAGCCTGCAAAGCAGG - Intronic
985531007 5:433867-433889 AGCAGCACAGGATGCTGAGCAGG + Exonic
985896126 5:2751002-2751024 GGCCGCCCCGCAGGCTGAGCCGG - Intronic
987923356 5:24311205-24311227 GGCAGCACTGCCTGCTGAGGAGG + Intergenic
989139686 5:38190262-38190284 TGCCGCTCACCCTCCTGAGCCGG - Intergenic
994824798 5:104699073-104699095 GGCTGCAGAGCCAGTTGAGCAGG - Intergenic
996118962 5:119649495-119649517 AGCAGCACTGCATGCTGAGCTGG - Intergenic
996832599 5:127756294-127756316 AGCCGCAGAGCCGGCTGTGCAGG + Intergenic
997645871 5:135481611-135481633 GGCCTCCCAGGCTGCTGGGCTGG + Intergenic
998046557 5:138991574-138991596 GGCAGCACAGGCTGCAAAGCAGG + Intronic
999348915 5:150848306-150848328 GGCCTCACCTCCTACTGAGCTGG + Exonic
1001936645 5:175710174-175710196 GGACCCACAGCCTGGTGAGGAGG - Intergenic
1002928257 6:1617520-1617542 GGCCCCACAGCCTTCTGTGGGGG - Intergenic
1006822976 6:36913314-36913336 GGCCCCACCCCCTCCTGAGCTGG + Intronic
1008535698 6:52504744-52504766 GCACGCAGAGCCTGCAGAGCAGG + Exonic
1010492995 6:76496268-76496290 GGCCTGACTGCCTGCTGGGCTGG - Intergenic
1014282144 6:119453412-119453434 GGCAGCACAGGGAGCTGAGCGGG + Intergenic
1015350292 6:132210197-132210219 GGCAGCTCAGGCTGCTGATCCGG + Intergenic
1018103185 6:160459243-160459265 GGCCCCAGAGCCCTCTGAGCTGG + Intergenic
1018800780 6:167220638-167220660 GGCCTTACCGCCCGCTGAGCGGG - Intergenic
1018809316 6:167286320-167286342 GGCCTTACCGCCCGCTGAGCGGG + Intronic
1019039785 6:169094324-169094346 GGACGGACAGCCTGCTGACCGGG - Intergenic
1019381527 7:726753-726775 GGCCCCACACCCGGCTGAGGGGG + Exonic
1020381703 7:7554932-7554954 GGCAGCACAGCCTGAGGAGCTGG + Intergenic
1020997181 7:15279271-15279293 AGCCAGGCAGCCTGCTGAGCTGG - Intronic
1021452962 7:20798594-20798616 GGCCGCGCAGGCTGCCCAGCAGG - Intergenic
1021556304 7:21922292-21922314 GGCCCCAAAGCCTGTTGAGTTGG - Intronic
1021624673 7:22581247-22581269 AGCCGCAAAGACTGCAGAGCTGG - Intronic
1025016018 7:55439752-55439774 GGCAGCAGATGCTGCTGAGCTGG - Intronic
1026374376 7:69735721-69735743 GGCCGCACAGCCCCCTGACAAGG + Intronic
1029032239 7:97480829-97480851 GGCCCCACAGACTGCACAGCTGG - Intergenic
1029366593 7:100120284-100120306 GGCCCCACACCCCGCTGAGGGGG + Intronic
1029729337 7:102429301-102429323 AGCAGCACAGCCTGCTGTGTGGG + Intergenic
1030737356 7:113065364-113065386 GGCAGGACAGCATGGTGAGCAGG + Intergenic
1033085869 7:138341315-138341337 GGCAGCACTGCCTGCTGAGGTGG - Intergenic
1034970131 7:155413543-155413565 GGCTTCTCTGCCTGCTGAGCTGG - Intergenic
1035039530 7:155917370-155917392 GGCCACATAGCCTGCAAAGCTGG + Intergenic
1035823084 8:2616048-2616070 TGCCACTCAGCCTCCTGAGCAGG - Intergenic
1036032962 8:4992713-4992735 GGAGGCAGCGCCTGCTGAGCAGG - Intronic
1040388814 8:46932727-46932749 GGCCCCAGAGCCTGCTGTGGAGG - Intergenic
1042647413 8:71002953-71002975 CTCCTCACAGCCTGCAGAGCTGG - Intergenic
1042785211 8:72537848-72537870 GCCCGTGCCGCCTGCTGAGCGGG + Exonic
1044313069 8:90717539-90717561 GGTCTCACAGCCTTCAGAGCTGG - Intronic
1047791711 8:128210215-128210237 GGGCACAGAGCTTGCTGAGCTGG - Intergenic
1049255747 8:141612764-141612786 GGCAGCCCAGCCTACTCAGCAGG + Intergenic
1049425323 8:142535546-142535568 GGCTGCAGAGCATGCTGAGGAGG + Intronic
1049442303 8:142614940-142614962 AGCTGCACATCCTGCAGAGCTGG - Intergenic
1049469716 8:142769883-142769905 ACCCGCAGAGTCTGCTGAGCGGG - Intronic
1049559808 8:143304327-143304349 GGACTCCCAGCCTGCAGAGCTGG - Intergenic
1049608111 8:143539086-143539108 GGCCGCACAGCATGGTCGGCAGG + Exonic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1057181782 9:93034561-93034583 GGCCGCAGAGCAGGCTGGGCTGG - Exonic
1057228799 9:93306383-93306405 GGCAGGACACCCTGCTGAGTCGG - Intronic
1058662854 9:107282770-107282792 GACAGCACAGACTCCTGAGCTGG - Intergenic
1060114333 9:120928770-120928792 GGGGGCTCAGCCTGCAGAGCCGG - Intronic
1060221302 9:121765454-121765476 TGCAGGAGAGCCTGCTGAGCAGG + Intronic
1060221305 9:121765464-121765486 GGCCCAGCAGCCTGCTCAGCAGG - Intronic
1061547599 9:131313703-131313725 CGCAGCACAGCGTGTTGAGCAGG + Intergenic
1062170242 9:135130904-135130926 GGGCGCGCAGCCAGCTGAGCTGG + Intergenic
1062323022 9:135999567-135999589 GGCTGCTCAGATTGCTGAGCAGG - Intergenic
1062439647 9:136564047-136564069 GGCCCCACAGCTTTCTGGGCAGG - Intergenic
1062668611 9:137693379-137693401 CCCCGCATAGCCTGCTGAACTGG + Intronic
1187899544 X:24014709-24014731 GGGCACCCAGCCTGCTGAGAGGG + Intronic
1188872004 X:35383440-35383462 AGCTGTACAGCCAGCTGAGCTGG - Intergenic
1189660016 X:43286530-43286552 AGCCAGGCAGCCTGCTGAGCTGG - Intergenic
1191861459 X:65668848-65668870 GGCCAAACAGCTTGTTGAGCTGG + Intronic
1195060291 X:101187729-101187751 AGCAGCACTGCCTGCTGAGGCGG + Intergenic
1198968240 X:142250484-142250506 GGCAGCTCAGGCTGCTGATCCGG + Intergenic
1200010711 X:153118751-153118773 GGCCTCAGATCCTGCTGGGCTGG - Intergenic
1200028889 X:153281171-153281193 GGCCTCAGATCCTGCTGGGCTGG + Intergenic
1200206655 X:154321284-154321306 GGCTGCACAGCCTGCTCAGGTGG + Intronic
1200211030 X:154346661-154346683 GGCCTCACAGGGTGGTGAGCTGG - Intergenic
1200219822 X:154385431-154385453 GGCCTCACAGGGTGGTGAGCTGG + Intergenic
1201317511 Y:12662285-12662307 GACCGCCCAGCCAGCTGCGCAGG - Intergenic
1201700784 Y:16879214-16879236 GGTCTCACAGCCTTCAGAGCTGG - Intergenic
1201898752 Y:19024096-19024118 GACAGCACAGACTGCTGAGTGGG - Intergenic