ID: 1122265916 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:100546761-100546783 |
| Sequence | GTGCGCGCGCGCGCGCGCGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 740 | |||
| Summary | {0: 4, 1: 15, 2: 38, 3: 155, 4: 528} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1122265916_1122265917 | 29 | Left | 1122265916 | 14:100546761-100546783 | CCGGCGCGCGCGCGCGCGCGCAC | 0: 4 1: 15 2: 38 3: 155 4: 528 |
||
| Right | 1122265917 | 14:100546813-100546835 | CTCACACACACCCAGCCTCCCGG | 0: 1 1: 0 2: 6 3: 106 4: 697 |
||||
| 1122265916_1122265918 | 30 | Left | 1122265916 | 14:100546761-100546783 | CCGGCGCGCGCGCGCGCGCGCAC | 0: 4 1: 15 2: 38 3: 155 4: 528 |
||
| Right | 1122265918 | 14:100546814-100546836 | TCACACACACCCAGCCTCCCGGG | 0: 1 1: 0 2: 3 3: 46 4: 505 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1122265916 | Original CRISPR | GTGCGCGCGCGCGCGCGCGC CGG (reversed) | Intronic | ||