ID: 1122266325

View in Genome Browser
Species Human (GRCh38)
Location 14:100548598-100548620
Sequence CAGGGTGCCCAGAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 1, 2: 5, 3: 63, 4: 416}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122266325 Original CRISPR CAGGGTGCCCAGAAGGGGCA GGG (reversed) Intronic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900155230 1:1201204-1201226 CCGGGTGCGGAGAAGGGGCCGGG - Intergenic
900322572 1:2092369-2092391 CAGGGTGCCCAGAGAGGGCGGGG + Intronic
900623103 1:3596419-3596441 CAGGGTGCCCTGAGGTGGCCGGG - Intronic
900749777 1:4388010-4388032 CAGGAAGCCAAGAAGAGGCAGGG - Intergenic
901146575 1:7069070-7069092 CCGGGGGCCCAGCAGGGTCAAGG - Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901663930 1:10815892-10815914 CTGGGAGCCGAGCAGGGGCAGGG - Intergenic
901929108 1:12585649-12585671 CAGATTCCCCAGAAGGGTCAGGG - Intronic
902554721 1:17240170-17240192 CAAGGTGTCAGGAAGGGGCAGGG + Intronic
902654549 1:17858550-17858572 GAGGGTGACCAGAACTGGCAAGG + Intergenic
902731132 1:18369602-18369624 CAGGGTGCCCTGATGGTGCAAGG - Intronic
902994887 1:20216632-20216654 CGGGGTCCCCAGATGGGGCAGGG + Intergenic
902998021 1:20242864-20242886 CAGGGATCCCAGAGGGGACAGGG + Intergenic
903275433 1:22218423-22218445 CAGGACGCCTAGAAGGGGCTGGG - Intergenic
903276983 1:22228637-22228659 CAGGCTGCCCAGGAGTGGCTGGG + Intergenic
903793009 1:25906941-25906963 CAGGGGGCCCTGCAGGGGCGTGG - Intronic
903850726 1:26304309-26304331 GAGGCTGCCCAGACAGGGCAGGG - Intronic
904001073 1:27339115-27339137 CAGGGAGCACAGAAGGCCCAGGG + Intergenic
904585431 1:31577206-31577228 CTGGGTGCCCAGCAGGGTCGTGG + Exonic
904619438 1:31766497-31766519 CCGGGGGCTCAGTAGGGGCAAGG + Intergenic
904675151 1:32194710-32194732 CATGGTGCAGAAAAGGGGCACGG - Intronic
905271312 1:36789535-36789557 CAGCTTGCCCAGAAGGGGTAAGG - Intergenic
905907848 1:41631488-41631510 CAGGGTGCCCAAGAGGAGAAAGG - Intronic
905940728 1:41861171-41861193 CATGGTCCCCAGATGGAGCATGG - Intronic
906575571 1:46886410-46886432 CAGGTTGCCCAGAAAAGGGAGGG + Intergenic
906596405 1:47081486-47081508 CAGGTTGCCCAGAAAAGGGAGGG - Intronic
906723053 1:48023261-48023283 CAGGCGGGGCAGAAGGGGCAGGG - Intergenic
907271928 1:53296367-53296389 CTGGGTGCACAGAAGGGACTTGG + Intronic
907328747 1:53657881-53657903 GAGGGTGCAGAGAAGGGGCAAGG - Intronic
911002409 1:93180192-93180214 CAGAGCGGCCAGAAGGAGCACGG + Exonic
911182727 1:94875502-94875524 CAGGAGGCTCAGAAGGGGCAAGG - Intronic
911912442 1:103653314-103653336 CAGGATGACAATAAGGGGCAAGG - Intergenic
911916012 1:103698634-103698656 CAGGATGACAATAAGGGGCAAGG + Intronic
912225544 1:107729547-107729569 CATGGTGCACTGAAGGGGCATGG + Intronic
912383668 1:109260845-109260867 CAGGGTGCCCATGAAGGGCTGGG + Intronic
912568492 1:110605875-110605897 AAGCCTGCCCAGAAGAGGCAAGG - Intronic
912754207 1:112310774-112310796 GAGTGTGGCCAGCAGGGGCACGG + Intergenic
914748173 1:150514496-150514518 CAGAGTGCGCACAAGGGTCAAGG + Intergenic
915270378 1:154749587-154749609 CAGGGTGCCAAGGAGGAGCCTGG + Intronic
915364952 1:155309835-155309857 CGGGGTGCCCAGTAGGGGGCTGG - Exonic
915449953 1:155997877-155997899 CTGGGTGCCCAGGCTGGGCATGG - Intronic
915593742 1:156884779-156884801 CAAGCTGCCCAGCAGGGGTAGGG + Intergenic
915929215 1:160048378-160048400 CAGTTGGCCCAGAAGGAGCAGGG - Intronic
915978967 1:160408472-160408494 CAGGGTGCACCGCAGGGGAAGGG - Intronic
916076095 1:161200722-161200744 GTGGGAGACCAGAAGGGGCAGGG + Intronic
916732255 1:167576783-167576805 AAGGGTGCCAAGAAGGGGATAGG - Intergenic
922168262 1:223133842-223133864 CAGAGGGCGCAAAAGGGGCAGGG + Intronic
922728966 1:227940229-227940251 CCTGGACCCCAGAAGGGGCATGG + Intronic
923271490 1:232359085-232359107 CAGGGTCCCCAGGAAGGGCCAGG + Intergenic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
923445768 1:234069811-234069833 CATGGTGCCCATCAGGGACAAGG - Intronic
924032525 1:239900671-239900693 CAGTGTGCTCAGAAGAGGTATGG + Intronic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1062972460 10:1659689-1659711 TGGGTTGCCCAGATGGGGCAGGG - Intronic
1063991962 10:11576266-11576288 GAGTGTACCCAGAAGAGGCATGG + Intronic
1064815800 10:19260551-19260573 CAGGGAGCTCAGCAGGGGTAGGG + Intronic
1065209346 10:23388030-23388052 GAGGGTGCTCAGAAAGGCCATGG - Intergenic
1065815523 10:29479445-29479467 CATCGTGCCCTGAGGGGGCAGGG + Intronic
1065957414 10:30705776-30705798 CATCGTGCCCTGAGGGGGCAGGG - Intergenic
1067145599 10:43691612-43691634 CAGGGCTGCCAGCAGGGGCATGG - Intergenic
1067202414 10:44184818-44184840 AAGGGAGCCCAGGAAGGGCAGGG + Intergenic
1067258559 10:44666501-44666523 CTGGGTCCCCAGAAGGGCCATGG + Intergenic
1069829097 10:71271781-71271803 CAAGGTGGCCAGCTGGGGCAGGG - Intronic
1069869707 10:71525754-71525776 CAGGTTTCCCAGGAGGGTCACGG - Intronic
1070543201 10:77432132-77432154 GAAGGTGCTCAGAAGGGGAAAGG - Intronic
1070584067 10:77747806-77747828 TAGGGTGTCCGGAAGGGGAATGG + Intergenic
1073186924 10:101620562-101620584 CAGGCTGGCCAGAGCGGGCAGGG + Intronic
1073353703 10:102837242-102837264 CAGGCTGCCCACCAGGGGCAGGG + Exonic
1073890756 10:108097563-108097585 CATGGAGCCCAGCAGGGGCCAGG - Intergenic
1074467045 10:113692511-113692533 CAGGCAGACCAGAAGGGGCGTGG - Intronic
1075106456 10:119542878-119542900 CGGGGTGCCCGGGCGGGGCAGGG + Intergenic
1075614924 10:123883887-123883909 CAGTGTGCAGAGAAGGGGCCAGG + Intronic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1076617284 10:131763892-131763914 CAGGGTGCAAAGAAGAGGAAAGG + Intergenic
1076819127 10:132930044-132930066 CAGGGTGTCCAGTAGGGACGTGG - Intronic
1076930819 10:133530558-133530580 CAGGGTGCTCAGAAAGTGCCTGG - Intronic
1077050467 11:564153-564175 CAGGGTGCTCAGTAGGGCCCAGG + Intergenic
1077065238 11:638130-638152 CAGGGTTCTCAGCAGGGGCCTGG - Intronic
1078097727 11:8310952-8310974 CTGGGGGCCCAGGAGGGGCAGGG - Intergenic
1078328348 11:10398417-10398439 CAGGGAGGCCAGAGGGTGCATGG + Intronic
1078567615 11:12430479-12430501 CTGTGTGTCCAGGAGGGGCAAGG - Intronic
1078672451 11:13377146-13377168 CAGCGTGGACAGCAGGGGCAGGG - Intronic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1081702224 11:45159133-45159155 CAGGGTGCTCAGGGAGGGCAGGG - Intronic
1081735058 11:45397000-45397022 CAGTGTGCCCAGAGAGGGCATGG - Intergenic
1081763426 11:45592770-45592792 CAGGCAGCCCAGAAGGGCCACGG + Intergenic
1083388800 11:62333198-62333220 CAGCGAGGCCAGAAGGGGGATGG + Intergenic
1083417287 11:62533942-62533964 CACAGTGACCAGAAGGGTCACGG - Exonic
1083672642 11:64307536-64307558 CAGTGTACCCAGAGGGTGCAGGG - Intronic
1083715617 11:64574390-64574412 CAGGGTGCCCATCTAGGGCATGG - Intergenic
1083892020 11:65600184-65600206 GTGGGTGGGCAGAAGGGGCAGGG - Intronic
1083952346 11:65963864-65963886 GAAGGTGCACAGAAGAGGCAGGG + Intronic
1084554543 11:69868130-69868152 CTGGGTGCCCACAAGGGCCTGGG - Intergenic
1085021572 11:73213441-73213463 CAGGCTGCCCAGGAGGAGCTAGG + Intergenic
1087272279 11:96123725-96123747 CAGTGTGCACAGATGGGGAAGGG + Intronic
1089683691 11:120133612-120133634 CAGGGTGCCCTGGAGGGGCTGGG - Intronic
1089747970 11:120630172-120630194 CAGGGTCCCCACACAGGGCAAGG - Intronic
1090420076 11:126568566-126568588 CAGGGAGGCCACATGGGGCAGGG + Intronic
1090788324 11:130069477-130069499 AAGAATGCCCAGCAGGGGCAGGG + Intergenic
1091329975 11:134724759-134724781 CAGGGCCCCCAGCAGAGGCAGGG - Intergenic
1094213979 12:27921341-27921363 CAGGGGGCCCAGAAATAGCAAGG - Intergenic
1096101624 12:48973443-48973465 CCAGGTGCCAAGAAGGGGCGAGG + Intergenic
1096496415 12:52041835-52041857 CAGGCTGCCTGGGAGGGGCAGGG - Exonic
1096773578 12:53951107-53951129 TAAGTTGCCCCGAAGGGGCAAGG + Intergenic
1103701741 12:122851711-122851733 CAGGGACCCCAGGAGGGGCAGGG - Intronic
1103937508 12:124484388-124484410 CAGTGTGCCTAGAGAGGGCATGG + Intronic
1104049103 12:125184628-125184650 CAGGGAGCCCAAAGGGGGCTTGG + Intergenic
1104640018 12:130461329-130461351 CAGGGGTGCCAGCAGGGGCAGGG + Intronic
1104846635 12:131850343-131850365 AAGTGTGCCCAGACGAGGCATGG - Intronic
1105726224 13:23164907-23164929 CAGGCTGCCCTGAAGAGGGAAGG - Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106415265 13:29541007-29541029 GAGTGTGCACAGAAGGGGCAGGG + Intronic
1106752752 13:32791841-32791863 CACAGTGCTCAGAAGGTGCAGGG - Intergenic
1107179913 13:37447087-37447109 CAGGGTGGCCAGGTGTGGCATGG - Intergenic
1108498152 13:51044972-51044994 CAGGTGGCCCAGAGTGGGCAGGG + Intergenic
1108638160 13:52356777-52356799 TAGTGTGCCCAGAGGGGACATGG + Intergenic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1111037984 13:82704539-82704561 TGGTGTGCCCAGAGGGGGCATGG + Intergenic
1111412620 13:87896125-87896147 TAGTGTGCCCAGACAGGGCATGG - Intergenic
1111771680 13:92604468-92604490 CTAGGTGCCCAGACAGGGCAAGG - Intronic
1112184327 13:97113647-97113669 CAGGCTGCACAAAAGGGGAAGGG - Intergenic
1112463749 13:99625216-99625238 CCAGGTTCCCAGAAGGGACAGGG - Intronic
1112569827 13:100583951-100583973 CAGGGTGACCAGAAAGTCCATGG + Exonic
1113280113 13:108779532-108779554 CAGGGTGGCCAGAAGCTTCAGGG + Intronic
1113445619 13:110364155-110364177 CATGCTGCACAGAAAGGGCAAGG + Intronic
1113478002 13:110599056-110599078 CAGGGTCCCCAGAGGGGCCAGGG + Intergenic
1113674901 13:112200423-112200445 CAGGGTGCCCACCAGAGCCAGGG + Intergenic
1114613680 14:24057464-24057486 CAGGGTGCACAGCTGGGGAAGGG - Intronic
1116868682 14:50051830-50051852 CAAGGTGCCAAGATGGGGCATGG - Intergenic
1117612903 14:57502785-57502807 CAGTGTGCCCTGAAGTGGGAAGG + Intergenic
1118008434 14:61586168-61586190 CAGTGTGCCCAGAACAGCCAAGG + Intronic
1119212450 14:72842556-72842578 TGGGGTGCCTGGAAGGGGCACGG + Intronic
1121006970 14:90496593-90496615 GAGGGTGCGCAGCAGGAGCAGGG - Intergenic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1122740374 14:103868533-103868555 CTGGGGGCCCAGAGTGGGCAGGG - Intergenic
1123019893 14:105392766-105392788 CAGGCTGCCCAGCAGCGGCGAGG + Exonic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1125475446 15:40045110-40045132 TAGGGCCCCCAGAAGGGGCTGGG - Intergenic
1125606843 15:40944308-40944330 CAAGGTGCTCACAAGGGGCCTGG - Intergenic
1125796198 15:42405770-42405792 CATGGAGCCAAAAAGGGGCATGG - Intronic
1127844355 15:62856649-62856671 CAAGGTGGCCAGGAGGGGCAGGG + Intergenic
1128374194 15:67064328-67064350 CAGTCAGCCCAGAAGCGGCAGGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129292768 15:74581083-74581105 TGGTGTGCCCAGATGGGGCAGGG - Intronic
1129608389 15:77035756-77035778 CAGTGTCCCCAGAAGGGGAGGGG + Intronic
1130078441 15:80710180-80710202 CAGGGTCCTAAGATGGGGCATGG + Intronic
1130081646 15:80739062-80739084 AAGAGTGCCCAGAAAGAGCAGGG + Intronic
1130404174 15:83583351-83583373 TGGGGTGCCTAGAAGGAGCAGGG - Intronic
1131510105 15:93045034-93045056 GAGGGCGCCCAGGAGGGGCCGGG + Exonic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132635663 16:944841-944863 CAAGGTGCACCAAAGGGGCAGGG - Intronic
1132646645 16:1002292-1002314 CAGGGAGCCCAGAAGGGGGCTGG - Intergenic
1132726635 16:1341739-1341761 CAGGGAGTCCAGAAGCAGCAGGG - Intronic
1133038513 16:3047315-3047337 CTGGGTGCCTGGGAGGGGCAGGG + Intronic
1133846027 16:9454583-9454605 CAGGGTGCCAAGAAAGGAGATGG - Intergenic
1134588637 16:15434474-15434496 ACGGGTACCCAGAAGGGGCAGGG - Exonic
1135422638 16:22315244-22315266 CTCGGTGCCCGGAAGGGTCATGG + Intronic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136151880 16:28356615-28356637 CAGGGTGCCCTGAGGCGGCCAGG + Intronic
1136168115 16:28470452-28470474 CAGGGTGCCCTGAGGCGGCCAGG + Intronic
1136211199 16:28758668-28758690 CAGGGTGCCCTGAGGCGGCCAGG - Intronic
1136399036 16:30007847-30007869 CAGGTGGCTCAGAAGTGGCAGGG - Intronic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1138106629 16:54290500-54290522 CAGGGTGCCCAGCACTGGCCCGG - Intergenic
1138286254 16:55812585-55812607 GAGGGGGCCTAGAAGGGGGAAGG - Intronic
1138558455 16:57786453-57786475 CAGGGCGCCAAGAATGGCCATGG + Intronic
1139400238 16:66675538-66675560 CAGGGAGCCCAGCAGGGCCAGGG - Intronic
1139923440 16:70473324-70473346 CAGCGTGGCCAGCAGGGGCCCGG - Exonic
1141177545 16:81730720-81730742 CAGGATGCCCAGAATGGGCGGGG + Intergenic
1141185133 16:81781560-81781582 CAGGTTGCCCTAAAGGAGCAGGG + Intronic
1141185320 16:81782922-81782944 CAGGTTGCCCTAAAGGAGCAGGG - Intronic
1141642516 16:85349522-85349544 GAGTGTCCCCAGCAGGGGCAGGG + Intergenic
1141797571 16:86285527-86285549 CTGGGTTCCCAGAAGCTGCAGGG + Intergenic
1141974117 16:87503409-87503431 CAGGGAGCGCAGAAGTGCCAGGG + Intergenic
1142115672 16:88354918-88354940 CAGGGTCTCCAGTGGGGGCAGGG + Intergenic
1142191750 16:88721339-88721361 CAGGGAGCCGAGGAGGGGCCAGG - Exonic
1142200869 16:88760602-88760624 CAGGGAGCCCAGGACAGGCAGGG + Intronic
1142292158 16:89198165-89198187 CATGGTGCCCAGCAGCAGCACGG + Exonic
1142617016 17:1142663-1142685 AAGGCTGCCCGGAAGAGGCAGGG + Intronic
1143180542 17:4981610-4981632 CAGGGCTCCCAGAGGGGCCATGG - Intronic
1143465534 17:7133956-7133978 TGGGGTGGCCAGAAGGGGGATGG + Intergenic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143670577 17:8393153-8393175 CAGGCTGTCCAGTGGGGGCACGG + Exonic
1143770455 17:9165217-9165239 CAGAGAGGCAAGAAGGGGCAGGG + Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144729348 17:17517764-17517786 CAGGCTGGGCAGCAGGGGCAGGG - Intronic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1145056054 17:19704739-19704761 CAGCGTCCCCAGCAGGGCCATGG - Intronic
1146138856 17:30347350-30347372 GATGGTGCCCAGAGAGGGCATGG + Intergenic
1146512269 17:33460288-33460310 CAAGGTGCCAAGAAGGGGATGGG + Intronic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1146902942 17:36600099-36600121 CAGGGAGCCCTGCAGGGCCAGGG + Intronic
1147371580 17:39996477-39996499 CAGGGGGCCCAGAATGGGGAGGG + Intronic
1147615574 17:41825413-41825435 CAGGGTGGCCAGCAGTGGCTGGG - Intronic
1147623851 17:41886390-41886412 CAGCCTGGCCAGAAGGGGCTGGG - Intronic
1147978389 17:44260604-44260626 CAGGGGGTCCAGAAGGGCCCAGG + Intronic
1148287839 17:46411576-46411598 CAGGTTGGCCAGAAGTGGGATGG + Intergenic
1148310008 17:46629156-46629178 CAGGTTGGCCAGAAGTGGGATGG + Intronic
1149388896 17:56170260-56170282 CAGGTATCCCTGAAGGGGCAGGG - Intronic
1149398704 17:56271632-56271654 GAGGGTGACCAGGAAGGGCAGGG + Intronic
1151359909 17:73582621-73582643 CAGGCTGCCCAGCAGGGTCAAGG - Intronic
1151544830 17:74786376-74786398 CTTGGTGCACAGATGGGGCAGGG - Intronic
1151684617 17:75639409-75639431 CAGGGTGCCCAAGAGGCCCAAGG - Exonic
1151817172 17:76477083-76477105 CAGGGTGCTCAGAAGGGGCTTGG + Intronic
1151837569 17:76593289-76593311 CAGGGTGCCCAGGAAGGGCATGG + Intergenic
1152341541 17:79728570-79728592 CGGGGTGCACAGAAGGGGCCTGG - Intergenic
1152784607 17:82241275-82241297 CAGGGGACCCAGAAAGGGCTTGG + Intronic
1152939629 17:83161362-83161384 CTGTGTGCCCAGAAGAGGCAGGG - Intergenic
1153781769 18:8501071-8501093 CAGGGAGACAGGAAGGGGCACGG - Intergenic
1155390683 18:25333382-25333404 GAGGGTGGGCAGAAGGGCCAGGG + Intronic
1155412441 18:25561602-25561624 CAGGTTGCCCAGAACTGGGAGGG + Intergenic
1155568576 18:27164109-27164131 CAGGTTGCCCCGAAGAGGGAAGG + Intronic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157410899 18:47462081-47462103 CAGAGTGTCCAGAAGGGCCTTGG + Intergenic
1157433409 18:47649672-47649694 CATGCTGCCCAGAAAAGGCAGGG - Intergenic
1157565516 18:48676666-48676688 GAGGGTCCCCAGAAGGCTCAGGG + Intronic
1157619553 18:49008484-49008506 CAGGGGACCCAGGTGGGGCAGGG - Intergenic
1160191875 18:76721497-76721519 CATGGGGCACAGTAGGGGCAGGG + Intergenic
1160455652 18:78997165-78997187 CATGCTGCCCAGAGGGGGGAGGG - Exonic
1160497331 18:79383216-79383238 CAGGGGGCCCAGCCGGGGCAGGG + Intergenic
1160513077 18:79463358-79463380 CAGGGTGCTCAGAAGGGTCCTGG + Intronic
1160673724 19:377740-377762 CTGGGAGCCCAGAAAGGGGAGGG - Intergenic
1160779942 19:873113-873135 CAGGGCTCCGAGATGGGGCAGGG + Intronic
1160793890 19:935045-935067 CAGGGGCCCCAGTAGGGGCCGGG - Intronic
1161208233 19:3053379-3053401 CGGGGTGCCCAGGACGGGAAAGG + Exonic
1161411849 19:4122002-4122024 TAGGGTGCCAAGGTGGGGCAGGG - Intronic
1161615594 19:5268522-5268544 CAGGAGGCCAAGATGGGGCAAGG + Intronic
1161631622 19:5359656-5359678 CAGGGGGCCAGGAAGGGGCCGGG - Intergenic
1161871908 19:6876816-6876838 CAGAGTGCCGGGAAGGGGCAGGG - Intergenic
1162018267 19:7857160-7857182 CAGGGTGCAGGGAAGGGGCCAGG - Intronic
1162409995 19:10499950-10499972 CACAGTGCCCTGAGGGGGCAGGG - Exonic
1162471070 19:10872128-10872150 CAAGGTGCCCAGAGTGAGCAAGG + Intronic
1162534184 19:11253420-11253442 CAGGGTGACAAGCAGCGGCAGGG + Intronic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162811505 19:13166917-13166939 CAGGTAGCCCAGGAGTGGCAAGG - Intergenic
1162905081 19:13818399-13818421 TAGGGGGCCTTGAAGGGGCAGGG - Intronic
1163228088 19:15979184-15979206 CAGGGAGCCCAGAAGAGAAAGGG + Intergenic
1163555404 19:17989496-17989518 CATGGTGCATAGAAGGGGCCTGG + Intronic
1164208296 19:23075569-23075591 CAGGGCGCCCAGCAGGGACGCGG - Intronic
1164667865 19:30053407-30053429 CAGGGAGCTCCGAAGGGGCAGGG - Intergenic
1165861387 19:38911325-38911347 CAGAGGGGCCAGATGGGGCAGGG - Intronic
1165992722 19:39825656-39825678 CAGGGCCCCCAGATGGGGGAGGG + Exonic
1166144680 19:40826003-40826025 CAGGGACCCCAGATGGGGCAGGG - Intronic
1166183063 19:41122204-41122226 CAGGGACCCCAGATGGGGCAGGG + Intronic
1167432551 19:49462744-49462766 CAGGGTGCACAGGTGAGGCAGGG + Exonic
1167445558 19:49535096-49535118 CTGGGGGCCCAGGAGGGGGAGGG - Intronic
1167472294 19:49682075-49682097 CAGGGTGGCCAGGCGGGGCCGGG + Intronic
1167529010 19:50003189-50003211 CAGGGTCCCCAGCAGGGCCTGGG - Intronic
1167756367 19:51415873-51415895 GAGTGTGCCCAGCAGGGGCCTGG - Intronic
1168281809 19:55309948-55309970 CAGGGGTCCAGGAAGGGGCATGG - Intronic
925187519 2:1859446-1859468 CAGGTTGCTCAGAACGTGCAAGG + Intronic
925275374 2:2644869-2644891 CAGGGTGCCCAGAGGTGGAGGGG - Intergenic
925275389 2:2644914-2644936 CAGGGTGCCCAGAGGTGGAGGGG - Intergenic
925275404 2:2644959-2644981 CAGGGTGCCCAGAGGTGGAGGGG - Intergenic
925275418 2:2645004-2645026 CAGGGTGCCCAGAGGTGGAGGGG - Intergenic
925275432 2:2645049-2645071 CAGGGTGCCCAGAGGTGGAGGGG - Intergenic
925275446 2:2645094-2645116 CAGGGTGCCCAGAGGTGGAGGGG - Intergenic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
925428380 2:3770002-3770024 CAGGGTTCTGAGAAGGGGCGGGG + Intronic
925880181 2:8345746-8345768 CAGGGTGCCCAGAGGAGGCATGG - Intergenic
927812799 2:26189390-26189412 CAGGGTGCCCACTAGTGTCAGGG + Exonic
928275835 2:29899329-29899351 CAGGGGGCAAAAAAGGGGCAAGG - Intronic
928700845 2:33897000-33897022 AATTGTGCCCAGCAGGGGCAAGG - Intergenic
929587814 2:43127180-43127202 CAGGGAGCCCAGACGGGGCGTGG - Intergenic
930769823 2:55120104-55120126 CTGGGTGTCCAGAGTGGGCATGG - Intergenic
932878097 2:75474219-75474241 TAGGGTGGCCAGGAGGGGAACGG + Intronic
933438728 2:82282598-82282620 TAGGGAGGCCAGAAGGGGGATGG + Intergenic
933728234 2:85438252-85438274 CAGGGCACCAGGAAGGGGCACGG + Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
936674528 2:114699787-114699809 CAGAGGAACCAGAAGGGGCAAGG + Intronic
937378673 2:121355774-121355796 CAAGGTGGCCAGAAGTGGCAAGG + Intronic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938185838 2:129231148-129231170 CAGGGTGCCCTGGAGTGGCAAGG - Intergenic
938327529 2:130421448-130421470 CTGGGTGCCCGGAAGGGGAGGGG + Intergenic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
940044402 2:149393605-149393627 CTGGCTGCCCACAAGGGGCCAGG - Intronic
941990327 2:171549489-171549511 CAGTGTGCCCAGAATAGCCAGGG - Intronic
944175212 2:196821198-196821220 TAGGGTGTCCAGAGGTGGCATGG + Intergenic
946362581 2:219228342-219228364 CAGGGTTCCCAGGATGGGCGGGG - Intronic
946428926 2:219614351-219614373 CTAGGGGCCCATAAGGGGCATGG - Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946479998 2:220045914-220045936 CAGGGTGAAAATAAGGGGCATGG + Intergenic
947407032 2:229789144-229789166 CGGGGTGCGCAGCAGTGGCAAGG - Intronic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
947828750 2:233124472-233124494 CAGGGAGGCCAAAAGGGACAGGG - Intronic
948429301 2:237909064-237909086 CAGGCTGCCCCCATGGGGCAAGG + Intronic
948479975 2:238243099-238243121 CAGATTGCCCACAAGGGGCCTGG - Intergenic
948902055 2:240961032-240961054 CAGGGTGCCCAGAAAGGGAGTGG + Intronic
1169105008 20:2987271-2987293 CAGGGGTCCCAGAAGGGTCTGGG - Intronic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1170061695 20:12265817-12265839 CAGGGTGCCCAGTGAGGGCAGGG + Intergenic
1170550508 20:17472172-17472194 CAGGGTGCCCAGAGGGGCTGGGG - Intronic
1171070414 20:22062766-22062788 CAGCTTGCCCAGCTGGGGCAAGG - Intergenic
1172130269 20:32650584-32650606 AGGGATGCCCAGAATGGGCACGG - Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172799923 20:37568519-37568541 AAAGGTGACCAGAAGTGGCATGG + Intergenic
1174180316 20:48670304-48670326 CAGGGTTCTCAGCAGGGGCAGGG - Intronic
1174254786 20:49246460-49246482 CAGGGTGCCCAAGGAGGGCAGGG + Exonic
1175858369 20:62134903-62134925 CAGGGACCACAGAAGGGCCAAGG - Exonic
1175922203 20:62455544-62455566 CAGGGTGCAGAGAAGGGGCCTGG - Intergenic
1175996126 20:62813067-62813089 TGGGGTGCCCCGATGGGGCAGGG - Exonic
1176040107 20:63060767-63060789 CAGGGTGCCCGGAAGGCGGAAGG + Intergenic
1176425408 21:6545570-6545592 CAGTGCGCCCGGAAGGGGCGTGG + Intergenic
1178093209 21:29186134-29186156 CAGGAGGCCCAGAAGAGCCATGG - Intergenic
1178882707 21:36461660-36461682 CAGGAAGCCCAGAAGCTGCACGG + Exonic
1179631020 21:42678844-42678866 CAGGGTGCACAGACAGGGCTGGG + Intronic
1179680614 21:43018597-43018619 CAGGGTCCCCACAAAGGGCACGG + Intronic
1179700899 21:43153887-43153909 CAGTGCGCCCGGAAGGGGCGTGG + Intergenic
1179808398 21:43854612-43854634 CTGGGTGCACAGAAGGGCCAAGG + Intergenic
1179883511 21:44303539-44303561 CACGGTGTCCTGCAGGGGCAGGG - Intronic
1180061670 21:45388495-45388517 CAGGGTGGCCAGAAGAGGACAGG + Intergenic
1180696501 22:17754410-17754432 CAGGGTGCCCAGGGAGGGCAGGG + Intronic
1180800098 22:18627693-18627715 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1180851331 22:19023258-19023280 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1180865448 22:19116257-19116279 GAGGATGCCCAGAAGGTCCAGGG + Intronic
1180949665 22:19715337-19715359 CTGGGTGCCCAGATGGGTCCTGG + Intronic
1181007900 22:20022783-20022805 CAGGGACCCCAGAAGGGGTCTGG + Intronic
1181109379 22:20592258-20592280 CAGGGTGGGCAGCTGGGGCAGGG + Intergenic
1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG + Intergenic
1181221630 22:21367603-21367625 GAGGGTGGGCACAAGGGGCAGGG + Intergenic
1181554404 22:23659787-23659809 CAAAGTGTCCAGAATGGGCAAGG + Intergenic
1181639811 22:24190519-24190541 CAGGGGGCCCAAGAGCGGCAGGG + Intergenic
1182367590 22:29789329-29789351 GATGGAGCCCAGCAGGGGCAGGG + Intronic
1182515915 22:30859027-30859049 CATGGGGCCCTGAAGGGGTAGGG - Intronic
1183064269 22:35352779-35352801 CACGGTGCACAGAGGGTGCAGGG - Intergenic
1183351552 22:37337407-37337429 CAGGGAGCCCAGAAGGGCAGGGG + Intergenic
1183371507 22:37435170-37435192 CAGGGCGCCTGGAAGGGGCAAGG + Intergenic
1184286733 22:43476243-43476265 CAGGGTGCCCAGTGCTGGCAGGG + Intronic
1184296594 22:43529033-43529055 CAGGCTGCCAGGAAGGGGCTGGG + Intronic
1184415603 22:44350262-44350284 CAGGGTCCCCAGAAAGGCAAAGG + Intergenic
1184684763 22:46091193-46091215 GAGGTGGCCCAGAAGGGTCATGG + Intronic
1184742959 22:46439717-46439739 CAGGGTGCTCAGAACGGGGTTGG - Intronic
1184852989 22:47131505-47131527 CATGGAGCCCACAGGGGGCAGGG - Intronic
1185098510 22:48825067-48825089 CAGGGTTCTCAGGTGGGGCAGGG + Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185380485 22:50505509-50505531 CAGGGTGGCCAGCAGGGCCTTGG + Exonic
950494702 3:13326813-13326835 CAGGATGCCCCACAGGGGCAGGG + Intronic
950863627 3:16171899-16171921 CAGGTTCCCCAGCAGAGGCAGGG + Intergenic
952534668 3:34296959-34296981 CAGGGTGCCAAGAGGAGGAATGG - Intergenic
952974034 3:38679047-38679069 CAGGATGCCCAGAAGGACCAAGG + Intergenic
953662493 3:44901359-44901381 TGGGGTGCCCAGAAGGGCCAAGG - Intronic
953695154 3:45152496-45152518 TAAGGTGACCAGAAGGAGCAAGG - Intergenic
953878682 3:46680585-46680607 CAGAGTGCCCAGGAGGTACATGG - Intronic
954135012 3:48578461-48578483 CAGGGGGACCAGAGGGGCCAGGG + Exonic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
961454631 3:127017929-127017951 CAGGGTCCACAGGTGGGGCATGG - Intronic
962194840 3:133352730-133352752 TGGGATGCCCAGAAAGGGCATGG - Intronic
964292068 3:155192609-155192631 CAGGATTCCCAGAAGAGGGAAGG - Intergenic
965082600 3:164053946-164053968 CTGTGTGCCCAAAGGGGGCATGG - Intergenic
965172410 3:165283182-165283204 TAGGGTGCCTTGCAGGGGCAGGG + Intergenic
966694682 3:182777795-182777817 CAGGCAGCCCAAAAGGGCCAAGG + Intergenic
966834533 3:184038806-184038828 CAGGGGGCTCAGAATGGACAAGG + Exonic
966843326 3:184106524-184106546 CAGGGGGCTCAGAATGGACAAGG + Exonic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
968071894 3:195789315-195789337 CAGGGGGCCCAGAAGGACAATGG - Exonic
968603978 4:1522844-1522866 CAGGGTGCCCACATGGGGCAGGG + Intergenic
969090359 4:4689535-4689557 AAGGGTGCCCAGAGGCGGCCAGG - Intergenic
969164892 4:5299055-5299077 CAGGAAGCCCAGAAGGGGCTGGG - Intronic
969813812 4:9671138-9671160 CAGGCTGCCTAGAAGGGACGCGG - Intergenic
969869557 4:10096142-10096164 CAGGGTGCTCAGCAGGGTCAGGG - Intronic
970859130 4:20682033-20682055 CAGAGTGCCAAGAATGGACATGG + Intergenic
972573472 4:40330998-40331020 CAGGGTGAGCAGCAGGGGAATGG - Intergenic
974069367 4:57110205-57110227 CAGGCAGCCCAGCGGGGGCAGGG + Exonic
975202701 4:71609904-71609926 TGGTGTGCCCAGATGGGGCATGG + Intergenic
975404192 4:73969803-73969825 CAGAGTGCTGAGAAGGAGCATGG + Intergenic
976155939 4:82144797-82144819 CAGGAAGCCCAGTAGGGGAATGG - Intergenic
979366789 4:119834780-119834802 CATGGTGCTGAGATGGGGCAGGG + Intergenic
981704880 4:147648417-147648439 GAGGGTGCCCAGAGAGGGCATGG + Intronic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
985054405 4:186023901-186023923 CTGGGTGCCCAGCTGGGCCAGGG - Intergenic
985630756 5:1012786-1012808 CTGGGTGGCCAGGAGGGGCAGGG - Intronic
985705730 5:1400485-1400507 CAGGGAGCCCTGGAGGGGCTGGG - Intronic
986024492 5:3837898-3837920 CAGGCTGCCCAGACTGGGGAAGG + Intergenic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
989326151 5:40197788-40197810 CAGAGTGCCCAGAGGGCCCAGGG - Intergenic
989517886 5:42364420-42364442 CTGCCTACCCAGAAGGGGCAAGG - Intergenic
992761554 5:79955211-79955233 CAGGGTGCCAAGGAGGGTCCAGG - Intergenic
993172066 5:84431556-84431578 CAGGTGGACCAGGAGGGGCATGG - Intergenic
993718092 5:91295240-91295262 CAGTGTGCCCAGAAAAGGCATGG + Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997368723 5:133342321-133342343 CAGGTTGCAGAGAAGGGGCAGGG + Intronic
997589909 5:135066235-135066257 CAGGCTGCCCAGCAAGGGCCAGG - Intronic
997955229 5:138274168-138274190 CAGGGTGCCTGCAAGGGGCTGGG - Intronic
998217520 5:140248490-140248512 CAGGGTGCCCAGGTGGTGTATGG - Intronic
998923822 5:147100682-147100704 CACGGTGCCCAGAAGATGCCAGG + Intergenic
999141637 5:149366198-149366220 CAAGGTGCTCAGAATGGGCTGGG + Intronic
999249317 5:150172668-150172690 GAGGGGGCCCAGCAGGGGCCTGG + Intronic
999368231 5:151036844-151036866 TTGGGAGCCCAGAAGGAGCAGGG - Exonic
1001099118 5:168799604-168799626 CAGGGAGCCTGGCAGGGGCACGG + Intronic
1002055341 5:176595391-176595413 CAGAGGCCCCAGGAGGGGCAGGG + Intronic
1002474994 5:179459909-179459931 CAGGCTGCCCAAGAGGGGCCGGG - Intergenic
1002772882 6:304328-304350 CAGGGTGGGCAGGCGGGGCAGGG + Intronic
1002890162 6:1325082-1325104 CAGGGTGCAGGGAAGGGTCATGG - Intergenic
1002912965 6:1505295-1505317 CAGGGAGCCCAGAAGGTCCCAGG + Intergenic
1003108069 6:3230175-3230197 CTGGCTGCCCGGAAGGGGCAGGG - Intronic
1003411868 6:5872021-5872043 CAGTGTGCCCAGAAGAGGAATGG - Intergenic
1003778724 6:9398849-9398871 CAGGGTGCCCAGCGAGCGCAGGG + Intergenic
1004044775 6:12012747-12012769 GAGGGCGCCCAGAAGTGCCAAGG - Intronic
1006059537 6:31410242-31410264 GAGGCTGCCCTGCAGGGGCAAGG - Intronic
1006072026 6:31505313-31505335 GAGGCTGCCCTGCAGGGGCAAGG - Intronic
1006948192 6:37799628-37799650 CCACGCGCCCAGAAGGGGCAGGG - Intergenic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007263186 6:40577990-40578012 CAGGGGGCACAGAAGGGACGGGG - Intronic
1011146063 6:84218203-84218225 CAGGGAGACCAGAACAGGCAGGG + Intronic
1011572994 6:88760364-88760386 CAGTGTGCCTAGGAGAGGCAAGG - Intronic
1011714873 6:90094785-90094807 CAGGGGAACCAGAAGTGGCATGG - Intronic
1012521526 6:100126846-100126868 GAGGGTGCCCACAAGTGGCGAGG - Intergenic
1012603668 6:101130889-101130911 CTGGGTGGCAAGAAGGGGGAAGG + Intergenic
1012959287 6:105605624-105605646 TAGGGGGCCCACAAGGGGCTGGG - Intergenic
1016384194 6:143515071-143515093 CAGGGTGCCCAGGCGGGAGATGG + Intergenic
1016502211 6:144734466-144734488 CAGGGTGACGGGAGGGGGCAGGG - Intronic
1017614370 6:156229018-156229040 AAGGGGCCCCAAAAGGGGCATGG - Intergenic
1018030199 6:159835686-159835708 CTGGCTGCCCAGATGGGGTAGGG + Intergenic
1018206510 6:161441774-161441796 CAGGGTCCCAGGAAGGGCCAAGG + Intronic
1019100154 6:169623606-169623628 CAGGGTGCCCAAGAGAGCCATGG + Intronic
1019223438 6:170492967-170492989 CAAGGGGCCCAGAGGGGACAGGG + Intergenic
1019285847 7:222539-222561 CAGAGCCCCCAGGAGGGGCAGGG - Intronic
1019298455 7:290984-291006 CAGGGCGCCCCGAGGGGACAAGG + Intergenic
1019299557 7:296377-296399 CTGGGGGTCCAGAAGGGGCCTGG - Intergenic
1019300333 7:299909-299931 CGGGGTGCCCTCACGGGGCAGGG - Intergenic
1019504481 7:1383944-1383966 CAGCCTGCCGAGGAGGGGCAGGG + Intergenic
1021636817 7:22702098-22702120 CATTGTGCCCAGAAGGGGAATGG - Intergenic
1021772150 7:24015462-24015484 AAGGGTGCCAAGAATGTGCAAGG + Intergenic
1022287922 7:28973333-28973355 GAGGGAGCACAGAAGGGACAAGG - Intergenic
1022525973 7:31037564-31037586 CAGGGTGCTCAGAAGAGAGATGG - Intergenic
1022528643 7:31053477-31053499 TAGGGGGCTCAGAAGGGACAGGG + Intronic
1023043425 7:36192383-36192405 TAGCATGCCCAGATGGGGCAGGG + Intronic
1023180381 7:37476402-37476424 TTTGGTGCCCAGAATGGGCAAGG + Intergenic
1023522268 7:41060436-41060458 CAGGCTGCCCAGTCGGGGCTTGG - Intergenic
1023889546 7:44382487-44382509 CAGGGTGCCCCATAGGGACAGGG - Exonic
1023977154 7:45039092-45039114 CAGGGGGCTCAGGAGGGGCATGG + Intronic
1024657087 7:51459996-51460018 CAGGATTCCCAGAAAGAGCAAGG + Intergenic
1028272875 7:88815546-88815568 AAAGGTGCCCACAAGGGGGAAGG - Intronic
1028489796 7:91398615-91398637 CAGAGTGCCCTGAAGGGAGATGG - Intergenic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029402588 7:100355241-100355263 GTGGGTGCCAAGGAGGGGCAAGG + Intronic
1029424274 7:100486672-100486694 CAGGGTTGCCAGAAGGTCCAGGG - Intronic
1029451270 7:100642840-100642862 CAGGGTGCAGTGGAGGGGCACGG - Intergenic
1031694490 7:124832942-124832964 CACGGTGCCCAGTACTGGCAAGG + Intronic
1035106624 7:156446525-156446547 CAGAGGCCCCAGCAGGGGCAAGG - Intergenic
1035530857 8:349898-349920 CAGGGAGCCCAGCAGAGGAAGGG + Intergenic
1035563868 8:628523-628545 CAGGGTGACCCCAAGGGGCTGGG + Intronic
1035717767 8:1766897-1766919 CAGGCAGCACAGAAGGGGTATGG - Intronic
1038480552 8:27898927-27898949 CGGCGTGCCCAGAGAGGGCAGGG + Intronic
1038600979 8:28942123-28942145 CAGGGTGCCCCGGAGGTGCCAGG + Intronic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1040986129 8:53296208-53296230 GAGGGTGGCCAGAGAGGGCATGG - Intergenic
1043448264 8:80340474-80340496 CAGCTTCCCCAGATGGGGCAAGG + Intergenic
1045033128 8:98156316-98156338 CAGGGTGTCAAGAATCGGCAGGG + Exonic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1047486340 8:125334435-125334457 CAGAGAGCCTAGAAGGAGCATGG + Intronic
1048403301 8:134092801-134092823 CAGGAGTCCCAGAAAGGGCAGGG + Intergenic
1048573348 8:135672539-135672561 GAGGGTGCTCAGAAGGAGCGGGG - Intergenic
1049278565 8:141732262-141732284 CAGGGAGCCCAGAAGGACAATGG - Intergenic
1049359174 8:142203856-142203878 CAGGGTGGTCAGCAGGGGCGGGG + Intergenic
1049359184 8:142203880-142203902 CAGGGTGGTCAGCAGGGGCGGGG + Intergenic
1049366245 8:142238213-142238235 CAGGTTGCTCAGAATGTGCAGGG + Intronic
1049610376 8:143552481-143552503 CAGGGACCCCAGAAGGGGACAGG + Intergenic
1049658300 8:143808550-143808572 CTGGGTGCCCAGGAGGGCCAGGG + Intronic
1050922370 9:11220369-11220391 TGGGGTGCCCTGAAGGGGCTTGG + Intergenic
1051346217 9:16153406-16153428 CAGGGTGCCCACAATCAGCAGGG - Intergenic
1053197185 9:36128303-36128325 AAGGGGGACAAGAAGGGGCATGG - Intergenic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1056507265 9:87269108-87269130 CACAGTGCCAAGATGGGGCAAGG + Intergenic
1057008186 9:91578949-91578971 CAGTCTGCTCAGAAGGGGCCAGG + Intronic
1057311549 9:93946251-93946273 CAGGGTGTCCGGAACGAGCAAGG - Intergenic
1057420167 9:94905869-94905891 CAGGGAGTGCAGAAGGGGCTGGG + Intronic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1060817437 9:126642561-126642583 GGGGGTGCCCAGAGGAGGCAGGG - Intronic
1060944564 9:127562252-127562274 CGTGGTGCCCAGACTGGGCAGGG - Intronic
1060983571 9:127807365-127807387 GAGGGTGCCCAGAGGCCGCATGG - Intronic
1061200654 9:129136657-129136679 GAGGGAGCGCAGGAGGGGCAGGG - Intronic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1061899547 9:133666016-133666038 CAGCCTCCCCAGAAGGGGAAGGG - Intronic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1062009844 9:134261072-134261094 CAGGGTGCCCCGAAGGGCTCCGG + Intergenic
1062481465 9:136754431-136754453 CAGGGTGCCCAGGAGGGGCAGGG + Exonic
1062679485 9:137770746-137770768 CTGGGTGCTCAGAGGAGGCAGGG - Intronic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1186583075 X:10841646-10841668 CAGGCTGCCAAGGAGGGCCACGG + Intergenic
1187391935 X:18891750-18891772 CAGGGTGACCCAAGGGGGCAGGG + Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1199982217 X:152927460-152927482 CAGGGGTCCCAGGAGGGGTAGGG - Intronic
1201895282 Y:18986025-18986047 CAGGGAAGCCAGAATGGGCATGG - Intergenic