ID: 1122267923

View in Genome Browser
Species Human (GRCh38)
Location 14:100555262-100555284
Sequence CACCCAGCCCGGGTTTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122267923_1122267929 0 Left 1122267923 14:100555262-100555284 CCTGTGGAAACCCGGGCTGGGTG 0: 1
1: 0
2: 0
3: 24
4: 195
Right 1122267929 14:100555285-100555307 GGCAGAATCGCCTCGCCTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 56
1122267923_1122267928 -3 Left 1122267923 14:100555262-100555284 CCTGTGGAAACCCGGGCTGGGTG 0: 1
1: 0
2: 0
3: 24
4: 195
Right 1122267928 14:100555282-100555304 GTGGGCAGAATCGCCTCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1122267923_1122267932 17 Left 1122267923 14:100555262-100555284 CCTGTGGAAACCCGGGCTGGGTG 0: 1
1: 0
2: 0
3: 24
4: 195
Right 1122267932 14:100555302-100555324 TGGCGGAGCCTCTCCTGTGCCGG 0: 1
1: 0
2: 1
3: 16
4: 156
1122267923_1122267933 20 Left 1122267923 14:100555262-100555284 CCTGTGGAAACCCGGGCTGGGTG 0: 1
1: 0
2: 0
3: 24
4: 195
Right 1122267933 14:100555305-100555327 CGGAGCCTCTCCTGTGCCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122267923 Original CRISPR CACCCAGCCCGGGTTTCCAC AGG (reversed) Intronic
900389746 1:2428793-2428815 CTCCCAGCCCGGGTTCCCCGAGG - Intronic
900390783 1:2432922-2432944 CACCCAGCCCGTGTGTGCACCGG - Intronic
900483133 1:2909011-2909033 CACCCAGCTCTGGCTTCCAAGGG + Intergenic
901180969 1:7341633-7341655 CAGCCAGCCCGGGCTTCCCATGG + Intronic
901649392 1:10734954-10734976 CACCCAGTCCGGCTTTCCAGAGG + Intronic
903338251 1:22638893-22638915 CACCTTGCCGGGGTTTCCAGAGG - Exonic
903828737 1:26162309-26162331 TCCCCAGACCGGGTCTCCACAGG - Exonic
905518771 1:38581505-38581527 CACCCACACCAGGTTCCCACAGG + Intergenic
912312914 1:108641212-108641234 CACGCAGCCCCGGTTCCCGCTGG + Intronic
912723945 1:112042779-112042801 GCCCCTGCCCGGGATTCCACTGG + Intergenic
919091867 1:192986920-192986942 CACACAGCCCCGGTTCCCGCTGG - Intergenic
920399753 1:205669523-205669545 CCCCCAGCCTGGGCTTCCACGGG - Intronic
1063675943 10:8140842-8140864 CACCCATCCCTGGCTTCCAGGGG - Intergenic
1067067178 10:43110727-43110749 CACCCTGCCCTGGTGTCCCCTGG - Intronic
1074455038 10:113589130-113589152 CTCCCGGCCCCGGTTCCCACAGG + Exonic
1074772572 10:116743032-116743054 CACCCAGCCCGCCTTTGCGCCGG - Intergenic
1077494251 11:2878543-2878565 CACCCAGCCAGGATTTCTTCAGG + Intergenic
1078672639 11:13378375-13378397 GCCCCAGCCCGGGTTCCCCCTGG - Exonic
1078891300 11:15560932-15560954 CACGCAGCCCGGGTTCCTGCCGG - Intergenic
1080845569 11:36023968-36023990 CACACAGCCAGGGTCTGCACTGG + Intronic
1083157730 11:60835459-60835481 CACCAAGGCAGGGTTTCCAGGGG + Intergenic
1083314566 11:61806420-61806442 CATCCAACCCCAGTTTCCACTGG - Intronic
1083571805 11:63765185-63765207 CGCCGAGCCCGGGGTGCCACTGG + Exonic
1084495952 11:69503600-69503622 CAAACAGCCCGGGTTTGAACTGG + Intergenic
1084889340 11:72228986-72229008 CATCCCGCCCTGGTTGCCACAGG + Intronic
1084909121 11:72373340-72373362 CGCCCAGCCGGGGTTGCCGCTGG - Intronic
1088590676 11:111399993-111400015 CACCCATCCCGGCTTTCTCCAGG - Intronic
1089373609 11:117978839-117978861 CACGCAGCCCCGGTTGCCGCTGG + Intergenic
1089667197 11:120027932-120027954 CAGCCACCCAGGGCTTCCACAGG + Intergenic
1091233491 11:134003214-134003236 CACGCAGCCCGGGTTCCCGCTGG + Intergenic
1091544918 12:1495226-1495248 CACCCAGCACGGGTGAGCACTGG + Exonic
1091846830 12:3662706-3662728 CACACAGCCTGGGTCTCCAATGG - Intronic
1097350001 12:58538240-58538262 CACCCAACCCACCTTTCCACTGG + Intergenic
1102031359 12:109741804-109741826 CTTCCAGCCCAGGTTTCCACAGG + Intronic
1103585938 12:121955829-121955851 AACCCAGGCCTGGTCTCCACTGG - Intronic
1103898190 12:124288278-124288300 TCCCCAGCTCTGGTTTCCACAGG + Intronic
1106221364 13:27748666-27748688 CACACAGCCCTGGTTCCCGCTGG + Intergenic
1106643464 13:31609178-31609200 CACACAGCCCCGGTTCCCGCTGG + Intergenic
1107259417 13:38472782-38472804 CACGCAGCCCTGGTTCCCGCTGG + Intergenic
1108099215 13:46936406-46936428 CACACAGCCCCGGTTCCCGCTGG + Intergenic
1108327466 13:49348089-49348111 CAGCCTGCTCGGGTGTCCACAGG - Intronic
1110029168 13:70584185-70584207 CACCCAGCCCAGCTTGCCAATGG + Intergenic
1110999881 13:82165302-82165324 CACGCAGCCCCGGTTGCCGCTGG + Intergenic
1111333535 13:86792273-86792295 CACGCAGCCCTGGTTACCGCCGG - Intergenic
1113675052 13:112201590-112201612 CAGCCTGCCCAGGCTTCCACTGG + Intergenic
1113981600 13:114281457-114281479 CACACAGCCTGGCTTTCCGCCGG - Intergenic
1114560346 14:23585234-23585256 CATGCAGCCCCGGTTCCCACTGG + Intergenic
1116390492 14:44384751-44384773 CACGCAGCCCCGGTTCCCGCTGG - Intergenic
1121559697 14:94865173-94865195 CAGCCACCCCCGATTTCCACAGG + Intergenic
1122267923 14:100555262-100555284 CACCCAGCCCGGGTTTCCACAGG - Intronic
1122275187 14:100587391-100587413 CACCCCGCCCGGCTTCCCGCAGG + Intronic
1124177143 15:27436840-27436862 CACCAAGCCCGGCTTGCCCCTGG - Intronic
1125987601 15:44070179-44070201 CACCCAGCCCTGGTTTCCTATGG - Intronic
1132695752 16:1201069-1201091 CTCCCAGCACCGCTTTCCACGGG + Intronic
1132855950 16:2044597-2044619 CACCCGGCCCCCGTTGCCACAGG + Intronic
1134165512 16:11926328-11926350 CACCCACCCCGAGTATCCCCTGG + Intergenic
1134489796 16:14688119-14688141 CACCCACCCCGAGTATCCCCTGG - Intronic
1134495176 16:14727236-14727258 CACCCACCCCGAGTATCCCCTGG - Intronic
1134500562 16:14766356-14766378 CACCCACCCCGAGTATCCCCTGG - Intronic
1134527102 16:14952969-14952991 CACCCACCCCGAGTATCCCCTGG - Intergenic
1134545301 16:15103379-15103401 CACCCACCCCGAGTATCCCCTGG + Intronic
1134580021 16:15362694-15362716 CACCCACCCCGAGTATCCCCTGG + Intergenic
1134714687 16:16351502-16351524 CACCCACCCCGAGTATCCCCTGG - Intergenic
1134722564 16:16394866-16394888 CACCCACCCCGAGTATCCCCTGG - Intergenic
1134944864 16:18317003-18317025 CACCCACCCCGAGTATCCCCTGG + Intergenic
1134952128 16:18357156-18357178 CACCCACCCCGAGTATCCCCTGG + Intergenic
1135363416 16:21833646-21833668 CACCCACCCCGAGTATCCCCTGG + Intergenic
1135448374 16:22537432-22537454 CACCCACCCCGAGTATCCCCTGG - Intergenic
1136150052 16:28341567-28341589 CACCCACCCCGAGTATCCCCTGG + Intergenic
1136166287 16:28455382-28455404 CACCCACCCCGAGTATCCCCTGG + Intergenic
1136196686 16:28659650-28659672 CACCCACCCCGAGTATCCCCTGG - Intergenic
1136213026 16:28773775-28773797 CACCCACCCCGAGTATCCCCTGG - Intergenic
1136257752 16:29053688-29053710 CACCCACCCCGAGTATCCCCTGG - Intergenic
1136307215 16:29380372-29380394 CACCCACCCCGAGTATCCCCTGG + Intergenic
1136320740 16:29482615-29482637 CACCCACCCCGAGTATCCCCTGG + Intergenic
1136435313 16:30221955-30221977 CACCCACCCCGAGTATCCCCTGG + Intergenic
1136485902 16:30571571-30571593 CAACCAGGCCGGGTCTCCCCGGG + Exonic
1136570667 16:31094697-31094719 CACCCAGCCAGGGCTCCCCCAGG + Exonic
1137056866 16:35750144-35750166 CATCCAGCCCTGGTATCCCCAGG - Intergenic
1139855346 16:69975368-69975390 CACCCACCCCGAGTATCCCCTGG + Intergenic
1139885062 16:70202483-70202505 CACCCACCCCGAGTATCCCCTGG + Intergenic
1139967741 16:70755067-70755089 CACGCTGCCCGGCTCTCCACGGG - Intronic
1140367454 16:74393030-74393052 CACCCACCCCGAGTATCCCCTGG - Intergenic
1140635471 16:76908083-76908105 CACCCAGCCAGGTGTTCCATTGG - Intergenic
1142373155 16:89694109-89694131 CCCCCAGCCCAGGCCTCCACAGG - Intronic
1142505633 17:361602-361624 CACACAGCCCCGGTTCCCACTGG - Intronic
1142642774 17:1294344-1294366 CACCCAGTCCTGGTCTCCCCAGG + Intronic
1147988170 17:44318347-44318369 CACCCAGCCAGGGTTCTCTCGGG + Exonic
1148328268 17:46796692-46796714 CAGACAGCCCGGGTGTCCCCTGG + Intronic
1152068480 17:78124071-78124093 CACCCACCCTGGGTGTGCACTGG + Exonic
1154116767 18:11618337-11618359 CACCCACCCCGAGTATCCCCTGG + Intergenic
1155772838 18:29723526-29723548 CACACAGCCCCGGTTCCCACTGG - Intergenic
1155852247 18:30788453-30788475 CACGCAGCCCTGGTTCCCGCTGG - Intergenic
1155965607 18:32032701-32032723 CACCAAGCCCGGCCCTCCACTGG - Intronic
1156997484 18:43485179-43485201 CCACCAACCCAGGTTTCCACCGG - Intergenic
1157405898 18:47422688-47422710 CAGCCAGCCCGGGCTGCCGCTGG - Intergenic
1159017859 18:63116416-63116438 GACCCAGGCTGGGTTCCCACAGG - Intergenic
1159804301 18:72937655-72937677 AACACAGCCTGGGTTTCCATAGG - Intergenic
1160030230 18:75250649-75250671 CACTCAGCCCTGCTTTCCCCGGG - Intronic
1160995816 19:1881576-1881598 CGCCCAGGCCGGGCCTCCACCGG + Exonic
1161237060 19:3203579-3203601 CATCCAGCCCCAGTGTCCACAGG + Intronic
1161699179 19:5785583-5785605 CAGCCAGCCCCGGTGCCCACCGG + Exonic
1164159587 19:22617789-22617811 AGCCCAGCCCGGGGGTCCACAGG - Intergenic
1164387935 19:27793204-27793226 CAGCCAGCCCGGGGGTCCAATGG + Intergenic
1164738156 19:30557494-30557516 CCCCCAGCCAGGTTGTCCACAGG - Exonic
1165096802 19:33413976-33413998 GCCCCAGCCCGGCTTCCCACAGG - Intronic
1165758147 19:38305790-38305812 CCCTCAGGCCGGGTGTCCACCGG - Intronic
1166049099 19:40247576-40247598 CACCCAGCCAGGGAGCCCACGGG + Intronic
1166260804 19:41639532-41639554 CAGCCAGCCTGGGTATCCAAGGG + Intronic
1167207730 19:48113754-48113776 CACCCAGCCCTGGGCACCACGGG - Intergenic
1167262567 19:48467403-48467425 AGCCCAGCCTGGGTTTCCACTGG + Intronic
925422868 2:3726112-3726134 CTCCCACCCCTGGTTTCCCCTGG - Intronic
930485469 2:52006808-52006830 CACGCAGTCCCGGTTCCCACTGG - Intergenic
936284810 2:111173671-111173693 CCCCCAGCCCTGCTCTCCACTGG - Intergenic
939509618 2:143089786-143089808 CACGCAGCCCCGGTTCCCGCTGG + Intergenic
948255973 2:236568178-236568200 CACCCACTCTGTGTTTCCACCGG + Intronic
948471014 2:238179155-238179177 CAGCCAGCAGGAGTTTCCACTGG + Intronic
948944460 2:241212401-241212423 TACCCAGCTCGGGGGTCCACAGG + Intronic
949050617 2:241895643-241895665 CACACAGCCCGGTTCTCCCCAGG - Intronic
1169105966 20:2994722-2994744 CATTCAGTCCAGGTTTCCACTGG + Intronic
1171375848 20:24693800-24693822 CACCCACCCCCGAGTTCCACAGG + Intergenic
1175327917 20:58142437-58142459 CCCTGAGCCCAGGTTTCCACAGG + Intergenic
1175700137 20:61130929-61130951 CTCCCACTCTGGGTTTCCACAGG - Intergenic
1175873920 20:62220602-62220624 CCCCCACCCCGGGTCCCCACAGG - Intergenic
1175964650 20:62654467-62654489 CACCCAGCCCAGGTCCCCACGGG + Intronic
1176688448 21:9875746-9875768 CACCCATGCAGGGTCTCCACTGG - Intergenic
1179794418 21:43774581-43774603 CACACAGCCCGGGCCTGCACAGG + Intronic
1179883229 21:44302041-44302063 CACCCAGCCGGCCTGTCCACAGG - Intronic
1180109278 21:45640492-45640514 CACCCAGCCCCTGCTTCCCCAGG - Intergenic
1180695954 22:17751741-17751763 CACACAGCCAGGGTTTCTCCTGG - Intronic
1180737282 22:18026811-18026833 CACCCAGCCCCGTTCCCCACAGG + Intergenic
1180791744 22:18578492-18578514 CAACCAGCCCGGGCTTCCCCAGG - Intergenic
1181229992 22:21416817-21416839 CAACCAGCCCGGGCTTCCCCAGG + Intergenic
1181248657 22:21518049-21518071 CAACCAGCCCGGGCTTCCCCAGG - Intergenic
1181390776 22:22579385-22579407 CACACAGCAGGGGTTTCCATGGG + Intergenic
1181403162 22:22664028-22664050 CACACAGCAGGGGTTTCCACGGG + Intergenic
1181407839 22:22697491-22697513 CACCCAGCAGAGGTTTCCACGGG + Intergenic
1181415829 22:22758286-22758308 CACCTAGCAGAGGTTTCCACGGG + Intronic
1181420121 22:22792073-22792095 CACCCAGCAGAGGTTTCCACGGG + Intronic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
1182516253 22:30860735-30860757 CACCCTACCAGGGTTCCCACAGG - Intronic
1182982701 22:34686495-34686517 CCCCAAGCCCAGGTTTCCAGAGG - Intergenic
1183042915 22:35196644-35196666 CACCCATGTCGGGTATCCACTGG - Intergenic
1184753335 22:46501969-46501991 CGCCCAGCCCTGTTTTCTACAGG - Intronic
1184849598 22:47112660-47112682 AACCCAGCCCGGGTGTTCGCAGG + Intronic
1184887168 22:47353559-47353581 CACCCAGCAGGGGAATCCACTGG - Intergenic
1185097586 22:48819942-48819964 CACTCTGCCCGTGTTTCCAGGGG + Intronic
949898051 3:8785002-8785024 CTCCCTGCCAGGGCTTCCACAGG + Intronic
950431123 3:12951811-12951833 CACCCTCCCTAGGTTTCCACTGG - Intronic
950661683 3:14470702-14470724 CACCCAGACCGGGGCCCCACTGG - Intronic
952132707 3:30383823-30383845 GACCCAGTGCTGGTTTCCACAGG - Intergenic
952765820 3:36953242-36953264 CACCCAACTAGGGTGTCCACAGG + Intergenic
954130870 3:48560305-48560327 CCCCCAGCCCTGCTGTCCACTGG + Intronic
954406420 3:50347794-50347816 CACCCTGCCCGGCTTTATACAGG - Exonic
957921780 3:86757602-86757624 CACTCAGCCCCGGTTCCCGCTGG - Intergenic
960465269 3:117990171-117990193 CAACCAGGCCAGCTTTCCACTGG - Intergenic
962806782 3:138933169-138933191 CACCCTGCCTGGGTCTCCAGGGG + Intergenic
963397172 3:144749821-144749843 CACGCAGCCCCGGTTCCCGCTGG - Intergenic
963503823 3:146160914-146160936 CACCCAGACAGGGATTCCAGGGG + Exonic
968500267 4:946725-946747 CACCCAGCCCCGGCTCCCACAGG + Intronic
968656525 4:1780700-1780722 GAGCCAACCCGGGTTTCCATGGG + Intergenic
969057655 4:4412258-4412280 CACCCAGGCCAGGTATCCAGCGG - Intronic
969058044 4:4414195-4414217 CACCCAGGCCAGGTATCCAGCGG - Intronic
969325612 4:6442199-6442221 CACACAGGCCAGGTTTCCAGTGG + Intronic
974590631 4:63943225-63943247 CGCGCAGCCCGGGTTCCCGCTGG + Intergenic
975683491 4:76897910-76897932 CGCCCGGCCAGGGTTTCCTCTGG - Exonic
977264896 4:94841982-94842004 TAACCAGCCCTGGTTTCCACTGG - Intronic
979302313 4:119101120-119101142 CACCCAGCCCTGTTTTCTACTGG - Intergenic
979949541 4:126874789-126874811 CACACAGCCCGGGTTCCCTCCGG + Intergenic
980337816 4:131499293-131499315 CACCCACCTCGGATTTCCAAAGG + Intergenic
980351823 4:131693541-131693563 CACCCATGCAGGGTCTCCACTGG - Intergenic
982728154 4:158927711-158927733 TGCGCAGCCCGGGTTCCCACTGG - Intronic
983064120 4:163190056-163190078 CACGCAGCCCCGGTTCCCGCTGG + Intergenic
984869056 4:184310928-184310950 CACGCAGCCCAGGTGTGCACTGG + Intergenic
988969474 5:36451781-36451803 CACCAAGCCCCAATTTCCACAGG + Intergenic
992748860 5:79843804-79843826 CTCCCAGCCCTGGCTTCAACAGG - Intergenic
993031831 5:82714690-82714712 CATGCAGCCCCGGTTCCCACTGG - Intergenic
994754642 5:103779125-103779147 CACGCAGCCCCGGCTCCCACTGG + Intergenic
996747131 5:126854880-126854902 CGCCCAACCCTGGTTCCCACCGG + Intergenic
998452670 5:142246771-142246793 CTCCCAGCCAGAGTTTCCATGGG - Intergenic
998543724 5:143007544-143007566 CACCCAGTCCTGCTTTCCAGAGG - Intronic
1001496279 5:172189412-172189434 CACCAAGCATGGTTTTCCACTGG + Intergenic
1001666377 5:173436726-173436748 TGCCCAGCCCTGGGTTCCACAGG - Intergenic
1003581410 6:7344227-7344249 CGCCCAGCCCCGGTTCCCGCTGG - Intronic
1005965855 6:30726158-30726180 CACCCAGCCCAGGATTCCTTTGG + Intergenic
1006339311 6:33437950-33437972 CGCCCAGCCAGGGTGGCCACTGG - Exonic
1011693133 6:89887937-89887959 CACACAGCCAGGCTCTCCACTGG - Intergenic
1014407490 6:121069272-121069294 CACCCACACAGGGTCTCCACTGG + Intergenic
1014507727 6:122280591-122280613 CGCGCAGCCCCGGTTTCCGCTGG - Intergenic
1017873160 6:158503029-158503051 CACCCAGCATGGGGTCCCACTGG - Exonic
1018913239 6:168116452-168116474 GACCCAGACAGGGCTTCCACTGG + Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1024825459 7:53385512-53385534 CACGCAGCCCCGGTTCCCGCTGG + Intergenic
1025639712 7:63354672-63354694 CAGCCAGCCCGGGGTCCAACAGG - Intergenic
1025642987 7:63393420-63393442 CAGCCAGCCCGGGGTCCAACAGG + Intergenic
1027783499 7:82550179-82550201 CACCATGCCCGGGCTTCCAATGG - Intergenic
1027956018 7:84880593-84880615 CGCGCAGCCCGGGTTCCCGCCGG - Intergenic
1028778288 7:94705505-94705527 CGCGCAGCCCGGGTTCCCACTGG - Intergenic
1029614525 7:101647960-101647982 CACACAGCCTGGGGTTCCACTGG - Intergenic
1031249105 7:119356970-119356992 CACCCACACAGGGTTTTCACTGG - Intergenic
1035435449 7:158856310-158856332 AACCCGCCCCGGGTTCCCACGGG - Intergenic
1036218006 8:6896869-6896891 CACCCAGCCTGGCCTTCCACGGG - Intergenic
1037359087 8:18054211-18054233 CCCACAGCCCGGGCTTCCTCTGG - Intergenic
1039546292 8:38413647-38413669 CACCCAGCCCAGCTTGCCAATGG - Exonic
1049372725 8:142275408-142275430 CACCGAGCCCGGCTTTTCCCAGG - Intronic
1049659874 8:143815155-143815177 CCCCCAGCCCGTGATTCCTCCGG - Intronic
1049867432 8:144947903-144947925 TACCCTGCCCGGGTGCCCACTGG + Intronic
1052985387 9:34483115-34483137 CACTCAGCCCCGGTTCCCGCTGG + Intronic
1058053574 9:100428564-100428586 CCCCTAGCCCGGGTCTCTACGGG - Intronic
1060759513 9:126235549-126235571 GACCCAGCCCGGGTTCCAGCTGG + Intergenic
1061379348 9:130244764-130244786 CACCCAGCCCCAGTGGCCACAGG + Intergenic
1187518066 X:19990691-19990713 GACCCGGCGCGGGTTTCCAGGGG - Intergenic
1193265595 X:79464492-79464514 CACCCATGCCAGGCTTCCACGGG - Intergenic
1194384345 X:93235740-93235762 CACCCATCCCCGGTTCCCGCCGG - Intergenic
1195179137 X:102339744-102339766 CAGCCCGGCCGGGTTTGCACAGG - Intergenic
1196741482 X:119029523-119029545 CACGCAGCCCCGGTTCCCGCTGG - Intergenic
1196881265 X:120200162-120200184 CACCCAGCCTAGGGTTCAACAGG + Intergenic
1199175498 X:144783642-144783664 CACGCAGCCCTGGTTCCCACTGG - Intergenic
1199513457 X:148649074-148649096 CACCCAGGCCTGCTTTCCAAAGG - Intronic
1199833061 X:151563131-151563153 CACGCAGCCCCAGTTGCCACCGG + Intergenic