ID: 1122272315

View in Genome Browser
Species Human (GRCh38)
Location 14:100573741-100573763
Sequence GGGAAATGGGCTTGGAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122272303_1122272315 9 Left 1122272303 14:100573709-100573731 CCTTGGCCATCCCAGGGGAGACA 0: 1
1: 0
2: 0
3: 25
4: 269
Right 1122272315 14:100573741-100573763 GGGAAATGGGCTTGGAGTTCAGG 0: 1
1: 0
2: 2
3: 23
4: 227
1122272302_1122272315 10 Left 1122272302 14:100573708-100573730 CCCTTGGCCATCCCAGGGGAGAC 0: 1
1: 0
2: 1
3: 20
4: 227
Right 1122272315 14:100573741-100573763 GGGAAATGGGCTTGGAGTTCAGG 0: 1
1: 0
2: 2
3: 23
4: 227
1122272308_1122272315 -2 Left 1122272308 14:100573720-100573742 CCAGGGGAGACACCAAGGGCTGG 0: 1
1: 0
2: 0
3: 25
4: 282
Right 1122272315 14:100573741-100573763 GGGAAATGGGCTTGGAGTTCAGG 0: 1
1: 0
2: 2
3: 23
4: 227
1122272301_1122272315 11 Left 1122272301 14:100573707-100573729 CCCCTTGGCCATCCCAGGGGAGA 0: 1
1: 0
2: 0
3: 40
4: 281
Right 1122272315 14:100573741-100573763 GGGAAATGGGCTTGGAGTTCAGG 0: 1
1: 0
2: 2
3: 23
4: 227
1122272307_1122272315 -1 Left 1122272307 14:100573719-100573741 CCCAGGGGAGACACCAAGGGCTG 0: 1
1: 0
2: 1
3: 26
4: 207
Right 1122272315 14:100573741-100573763 GGGAAATGGGCTTGGAGTTCAGG 0: 1
1: 0
2: 2
3: 23
4: 227
1122272304_1122272315 3 Left 1122272304 14:100573715-100573737 CCATCCCAGGGGAGACACCAAGG 0: 1
1: 0
2: 1
3: 22
4: 235
Right 1122272315 14:100573741-100573763 GGGAAATGGGCTTGGAGTTCAGG 0: 1
1: 0
2: 2
3: 23
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122272315 Original CRISPR GGGAAATGGGCTTGGAGTTC AGG Intronic
900615355 1:3563235-3563257 GGGAGATGGGCTTGGACCCCGGG - Intronic
900935984 1:5766573-5766595 GGGTAATGGGCTTGGTGTCCTGG - Intergenic
901291999 1:8131268-8131290 GGGCAATTGGCTTAGATTTCTGG - Intergenic
903143768 1:21356491-21356513 GGGGAAAGAGCTTGGTGTTCTGG - Intergenic
903379528 1:22887048-22887070 GGGCAAAGGGGTTGGGGTTCAGG + Intronic
903705121 1:25280010-25280032 TGGAAATGGGCCTGGAGCCCAGG + Intronic
903861343 1:26366625-26366647 GGGAATTGGGGTTGGAGTCTCGG - Intronic
904592464 1:31622655-31622677 GGGGCATGGGGCTGGAGTTCTGG - Intronic
906244066 1:44260906-44260928 GAGAAATGGGTGTGGAGGTCAGG - Intronic
906495360 1:46301630-46301652 GGGAAAAGGCCCTGGAGTTTGGG - Intronic
907431630 1:54415463-54415485 GGGAAACAGGCTTGGAGCTGTGG + Intergenic
908911926 1:69081371-69081393 GACAGATGGGCTTCGAGTTCAGG + Intergenic
910181405 1:84487057-84487079 GGGATGTGAGCTTGGAATTCAGG + Intronic
911599237 1:99830436-99830458 GGGAATTGGGTTTGGGGTTTAGG - Intergenic
912083814 1:105974979-105975001 GGAAAATGGGCTTTGAGTGTGGG + Intergenic
912736420 1:112153135-112153157 GAGAAATGAGCTTGGAATACGGG + Intergenic
913079472 1:115368990-115369012 TGGAAATGTCCTTGGAGTTTTGG - Intergenic
913597782 1:120394824-120394846 GGAAAATGGGCTAGGGGTTAGGG - Intergenic
914089551 1:144484490-144484512 GGAAAATGGGCTAGGGGTTAGGG + Intergenic
914226906 1:145728198-145728220 GGGAAATGGTCTTGGAACCCTGG + Intronic
914309060 1:146449722-146449744 GGAAAATGGGCTAGGGGTTAGGG - Intergenic
914593051 1:149123405-149123427 GGAAAATGGGCTAGGGGTTAGGG + Intergenic
917306642 1:173632555-173632577 GGGAGATTGGCTTGTAGTTTTGG - Intronic
922913132 1:229233985-229234007 GGGACATTGGCTTGGAGATCTGG + Intergenic
923447680 1:234087760-234087782 GGGAAATGAGCTGGGAGATGTGG - Intronic
1064520874 10:16199278-16199300 GGGAAAGGGGCAGGGAATTCCGG + Intergenic
1065506551 10:26435530-26435552 GGGAAATGGGATGGGAGTAAGGG - Intergenic
1067224948 10:44369493-44369515 GGGAAGAGGGCTTGGAGGACCGG + Intergenic
1068913058 10:62399562-62399584 TGGAAATGGGCCTTGAGATCAGG - Intronic
1069335690 10:67347289-67347311 GGGAAAATGGCTTTGAGCTCAGG - Intronic
1071299278 10:84244583-84244605 AGAAAATGGGGTTGGGGTTCTGG - Intergenic
1071788833 10:88933103-88933125 GGGAAATCTGATTGAAGTTCAGG + Intronic
1073111641 10:101066333-101066355 AGGACCTGGGGTTGGAGTTCCGG - Intronic
1074454638 10:113586635-113586657 GGGGAATGGGCTTTGACTTGGGG - Intronic
1078164499 11:8870876-8870898 GGGAAAAGGGCTGGGAGGGCAGG + Intronic
1079142331 11:17820198-17820220 AGAGAAGGGGCTTGGAGTTCAGG - Intronic
1079232133 11:18657830-18657852 GGGAAAGGGGCAGGGATTTCCGG + Intergenic
1081703024 11:45163833-45163855 GACAACTGGGCTTGGAGTTGAGG + Intronic
1082630056 11:55531187-55531209 GGGAAAGAGGCTTGGATGTCAGG + Intergenic
1083847668 11:65345431-65345453 TGGCCATGGGGTTGGAGTTCAGG + Intronic
1084154768 11:67307401-67307423 TGGAGATGGGCTTGAAGATCCGG - Exonic
1087116409 11:94529626-94529648 TGGACATGGGTTTGTAGTTCTGG - Intergenic
1087733783 11:101809000-101809022 CGGAAAAGGCCTTGGAGCTCAGG - Intronic
1087883600 11:103449242-103449264 GGGCAATGGGTTTAGAATTCAGG + Intronic
1088906225 11:114157261-114157283 GGGAAATGGGCTTTGGGGTCAGG + Intronic
1089715215 11:120352920-120352942 GGGGAATGGGCTGGGAGTACAGG - Intronic
1091654350 12:2334474-2334496 GCGAAGTGGGCTTGGATGTCTGG + Intronic
1091834876 12:3578659-3578681 GGATAAAGGGATTGGAGTTCAGG + Intronic
1092066263 12:5591902-5591924 GGGATGTGGCCTTGGAGTTGAGG + Intronic
1092845938 12:12585344-12585366 GGGAAATGGGATTGGAGCTCAGG + Intergenic
1092901603 12:13064886-13064908 GTGAAGTGGGCTTGGAGAACTGG + Intronic
1096617834 12:52844359-52844381 GGGAGATAAGCTTGGACTTCTGG - Intronic
1097046361 12:56189903-56189925 GGGAAAGGGGTTTGGGGTTTTGG - Intergenic
1099365039 12:81758486-81758508 GGGAAATGGTCCAGGAGTGCTGG - Exonic
1100224687 12:92544369-92544391 GCAAACTGGGCTTGAAGTTCAGG - Intergenic
1100916850 12:99433681-99433703 TGGACATGAGCCTGGAGTTCAGG + Intronic
1101489170 12:105196085-105196107 AGAAAATGGGCTTGTAGGTCTGG + Intronic
1103041429 12:117698695-117698717 TGGAAGTGGGTTTGGAGCTCTGG - Intronic
1105508948 13:21035475-21035497 GGGAGAGGGGCTCCGAGTTCTGG - Intronic
1107888801 13:44896300-44896322 GGGAAATGGGTTGGGAGGGCGGG - Intergenic
1108515101 13:51194074-51194096 GGTATATAAGCTTGGAGTTCAGG - Intergenic
1108741848 13:53346566-53346588 GGGACTTGGGCTTGGGGTTGGGG - Intergenic
1109494397 13:63148787-63148809 GGAAAGAGGGGTTGGAGTTCAGG + Intergenic
1113285601 13:108845019-108845041 GGGGAATGAGCTTGGAGTTATGG + Intronic
1114794110 14:25692985-25693007 AGCAAATGGTTTTGGAGTTCCGG + Intergenic
1116788849 14:49318231-49318253 GGGCAATGAGCTTGCAGTGCTGG - Intergenic
1117036881 14:51739335-51739357 GGGAAATGGGCAGGGTGGTCTGG - Intergenic
1118254664 14:64194962-64194984 AGGAAATGGGGAGGGAGTTCTGG - Intronic
1119711381 14:76824975-76824997 GGGAAATGCGCTGGGCGTTCAGG - Intronic
1121472253 14:94164983-94165005 GGGTGATGGGCTCGGAGTGCAGG - Intronic
1121714342 14:96062263-96062285 AGAAAATGGGCTTGGAGTGAAGG + Intronic
1121973619 14:98382358-98382380 GGGAGATAGTGTTGGAGTTCTGG + Intergenic
1122219965 14:100231588-100231610 TGGAAATTGTTTTGGAGTTCTGG - Intergenic
1122272315 14:100573741-100573763 GGGAAATGGGCTTGGAGTTCAGG + Intronic
1122693318 14:103541591-103541613 CAGAACAGGGCTTGGAGTTCTGG + Intergenic
1124623388 15:31293058-31293080 GGGGAAGGGGCTTTGAGTCCAGG + Intergenic
1125481410 15:40083569-40083591 GGGCAAAGGCCTGGGAGTTCTGG - Intergenic
1126362347 15:47859367-47859389 AGGAAATGGGCCTGGAATCCTGG - Intergenic
1126485253 15:49173048-49173070 GGGGAAAGGGAATGGAGTTCTGG - Intronic
1128053381 15:64682515-64682537 GGGAAAAGGGCAAGGAGTTGGGG - Exonic
1128661254 15:69502685-69502707 GGGAAAGGTGATTGGAGTTCTGG + Intergenic
1128683050 15:69665479-69665501 GGAAAATGGGCTTGGAGAGGAGG - Intergenic
1130863562 15:87912389-87912411 TGGAATTGGGTTTGGTGTTCTGG - Intronic
1130962773 15:88674518-88674540 GGAAAATAGAGTTGGAGTTCTGG + Intergenic
1131720816 15:95166517-95166539 TGCAAATGGGCTTGGAATTGTGG - Intergenic
1131887539 15:96933641-96933663 GGGAAATGGACTTGAAGCTGGGG + Intergenic
1132699092 16:1214675-1214697 GTGAAATGGGCTGGGGGCTCAGG + Intronic
1140163245 16:72521683-72521705 GGGAAATGGGTGTGGAATTATGG + Intergenic
1140495340 16:75381772-75381794 GAGATATGGGTCTGGAGTTCAGG + Intronic
1140550853 16:75863892-75863914 GAGAGATGGGCTTAGAGTTCTGG + Intergenic
1142267569 16:89071506-89071528 GGGAAATGCTCCTGGAGGTCAGG + Intergenic
1142352786 16:89587462-89587484 AGGAAACGGGCTTGGGGTTCAGG + Intronic
1143155188 17:4832174-4832196 GGAAAATGGGCTAGGGGTTAGGG + Intergenic
1143187803 17:5020968-5020990 GGGAAATGGGCATGGGGGTAAGG + Intronic
1144360720 17:14489344-14489366 GGGAAATGGGATAAGAGTTTTGG + Intergenic
1144772939 17:17769878-17769900 GGGAAATGGGCTTTGCCCTCAGG + Intronic
1147391673 17:40113033-40113055 GGGAAATGGAGTTGGAGTAGAGG + Intergenic
1148236684 17:45973856-45973878 GGGTCATGGGCTTGGATTTAGGG + Intronic
1149661288 17:58335312-58335334 GGGATCTGGGCTTGGAATCCTGG + Intergenic
1149978668 17:61291753-61291775 TGGAAATGGATTTGGAGTTCAGG + Intronic
1151053091 17:71001990-71002012 GGGAAAGGTGTTTGGGGTTCAGG + Intergenic
1151698082 17:75728188-75728210 GGGAAATGGGACTGGGGGTCTGG - Intronic
1151770225 17:76155753-76155775 GGGAAAGGAGCCTGGAGGTCAGG + Intronic
1153904469 18:9649100-9649122 GAGAAGTGTGCTTGGACTTCAGG + Intergenic
1154138167 18:11799184-11799206 GGGATATGGGCTTGGGATCCTGG - Intronic
1154829584 18:19513078-19513100 GGGAAACGGGATTGTACTTCAGG + Intergenic
1155111929 18:22724240-22724262 GGAATATGGGCTTGGTTTTCTGG + Intergenic
1160418170 18:78726447-78726469 GGGCAGTGGGCCTGGAGCTCGGG - Intergenic
1162658924 19:12154518-12154540 GGGAAATGGGCTTAGAACTCCGG - Intronic
1163693650 19:18751234-18751256 GGGAAATGGGCTGGGTGTGGTGG + Intronic
1163727029 19:18928700-18928722 TGGAAATGGACATGGTGTTCTGG - Intronic
1166106134 19:40599005-40599027 GGCAAATTGGCTTAGACTTCGGG - Intronic
1167427323 19:49436202-49436224 GGGACATGAGCTTGGGGTACAGG + Intronic
1168125314 19:54279483-54279505 GGGCATGGGGCTGGGAGTTCAGG + Exonic
1168176673 19:54632077-54632099 GGGCATGGGGCTGGGAGTTCAGG - Exonic
1168280407 19:55302502-55302524 GGGAAAAGGGGCTGGAGGTCTGG + Intronic
925904151 2:8529380-8529402 GGCAAATGGGCTTTGAATCCAGG - Intergenic
927784900 2:25966999-25967021 GGACATTGGGCTTGGAGTTAGGG - Intronic
932043869 2:68327669-68327691 AGGCACTGTGCTTGGAGTTCAGG - Intergenic
935559538 2:104545715-104545737 GGGAGATGGGGTGGGAGTGCAGG - Intergenic
936634783 2:114243606-114243628 GGGAAATGGGCTGGGTGTGGTGG + Intergenic
937242294 2:120470084-120470106 GAGTTATGTGCTTGGAGTTCAGG - Intergenic
937825390 2:126363618-126363640 GGGATATGTGCTTGGAGGTGAGG - Intergenic
941788909 2:169529082-169529104 AGTAAATGAGCTTGGAGGTCAGG - Intergenic
942237221 2:173922463-173922485 AGTCAATGGGTTTGGAGTTCAGG + Intronic
943563934 2:189495590-189495612 GGGAACTGGACTTGGACTTTTGG + Intergenic
943804212 2:192102413-192102435 GGAAAATAGGCTTGGAGTTGAGG - Intronic
944054562 2:195509981-195510003 GGTAAATAAGCTTGGAATTCGGG - Intergenic
946231691 2:218295456-218295478 GGGGAATGGGGTGGGGGTTCGGG + Intronic
947184866 2:227445800-227445822 GAGAAACAGGCTTGGGGTTCTGG + Intergenic
1173318996 20:41970740-41970762 GGTATATGGGCCTGGAGCTCAGG - Intergenic
1173562087 20:44013204-44013226 GGGCAAGGGCCTTGGAGTTAGGG + Intronic
1175507109 20:59493929-59493951 GAGAAAAGGGCTTGGAGATTGGG + Intergenic
1175565486 20:59972751-59972773 GGGAACTGGGCTTGGTTCTCAGG + Intronic
1175595274 20:60225832-60225854 GGGAAGTGGGCCTGGAGTTCAGG + Intergenic
1177669024 21:24201341-24201363 GGGACATGGGCATGGGGTTTGGG + Intergenic
1178784773 21:35643316-35643338 GGGAAGTGACATTGGAGTTCAGG - Intronic
1180619299 22:17149461-17149483 GGGAAAGGGACTTGGAGCTGGGG + Intronic
1180945186 22:19688721-19688743 GAGCAATGGCCTTGGAGGTCAGG + Intergenic
1180986276 22:19905645-19905667 GGGAAATGGCCTTGGATGTCTGG - Intronic
1180998669 22:19977848-19977870 GGGGAATGGGCTTGTGGGTCTGG - Intronic
1181955120 22:26582765-26582787 GGCAGATGGGCTTTGAGTCCTGG + Intronic
1182889453 22:33804917-33804939 GGGATATGAGCCAGGAGTTCTGG - Intronic
1183071615 22:35400295-35400317 GGGAACTGGGGTTGGAGTCCGGG + Intronic
1184692563 22:46123861-46123883 GGGGAGTGGGCTGGGAGTTGCGG + Intergenic
1185095002 22:48801352-48801374 GTGATATGGGCGTGGAGTTGGGG - Intronic
949581050 3:5388824-5388846 GGGAAACGGGCGTAGAGTACAGG - Intergenic
950040354 3:9915951-9915973 GGGGACTGGGCTGGGACTTCCGG - Exonic
952491936 3:33881785-33881807 GGGAAATGGGCTTTTGATTCTGG + Intergenic
953115206 3:39986169-39986191 GGGAATTGGGCTTGAATTTTTGG + Intronic
953706787 3:45237314-45237336 GGGAAAGGGGCATGGAGTGGAGG - Intergenic
954616839 3:51973479-51973501 AGAAAATGGGCTTTTAGTTCCGG - Intronic
956091017 3:65667193-65667215 GGGCAATGGGCTAGGCCTTCAGG + Intronic
960119618 3:113933952-113933974 GGCAAAGGGGCTGGGAGTTTTGG + Intronic
961150356 3:124632493-124632515 GGGAACTGTGGATGGAGTTCAGG - Intronic
961179797 3:124867572-124867594 GGAGAATGGGCTTGGTGTACTGG - Intronic
962630235 3:137268484-137268506 TGGAAAATGGCTTGGACTTCCGG - Intergenic
963852217 3:150220323-150220345 GGCAAATGGCCTTGGCGTTAGGG - Intergenic
966090481 3:176129589-176129611 GGGAAATGGCCGTGGCTTTCAGG - Intergenic
966658780 3:182390641-182390663 GGGAAATGGGCTTGGGAAACAGG + Intergenic
967640508 3:191857194-191857216 GGGATATGCCTTTGGAGTTCAGG - Intergenic
967932355 3:194699462-194699484 GAGAAATGGGCTTGGAGAAGAGG + Intergenic
968827091 4:2906785-2906807 GTGGAATGGGCATGGAGCTCTGG - Intronic
968970300 4:3790185-3790207 GGGACCTGGGCTTGGAGATGGGG + Intergenic
972266777 4:37468026-37468048 GGGAAATGAACTTTGGGTTCAGG + Intronic
972396119 4:38661249-38661271 GGGAAATGGGAGTAGAGGTCAGG + Intergenic
972528835 4:39943462-39943484 TAGAATTGGGTTTGGAGTTCAGG - Intronic
972579853 4:40385583-40385605 GGGAAGTGGGCTGTGAGTTCAGG + Intergenic
973126744 4:46595362-46595384 GAGAAATGGGGTTGGAGTTGTGG - Intergenic
976485023 4:85591747-85591769 GGGAAGTGGATTTAGAGTTCTGG + Intronic
976782376 4:88775337-88775359 AGAGAATGGGGTTGGAGTTCGGG + Intronic
977717992 4:100205218-100205240 GAGAAATGGGCCTGGACTCCTGG - Intergenic
978761234 4:112357815-112357837 TGGAAAAGAGCCTGGAGTTCTGG + Intronic
979931421 4:126636398-126636420 TGGAAATGGGGTTAGAATTCAGG + Intergenic
980907085 4:138958706-138958728 AGGAAATGGGGTTGGAGGTGCGG + Intergenic
982087223 4:151848179-151848201 GGGAAAGGGGCTGTGAGGTCAGG - Intergenic
984200156 4:176709612-176709634 AGGAAATGAGCTTGGCGTTCTGG + Intronic
984755241 4:183319939-183319961 GTCAAATGGGCTGGGATTTCTGG - Exonic
984755451 4:183322147-183322169 GTCAAATGGGCTGGGATTTCTGG - Exonic
985511334 5:315780-315802 GGGATGTGGGCTTGGGGGTCTGG + Intronic
985566913 5:623540-623562 GAGAAATGTTCTTGGAGTACGGG + Intronic
987184859 5:15406806-15406828 GGAAAATGGGGTTGGAATTACGG - Intergenic
987272319 5:16324294-16324316 GGGAAATGAGCTTGCATTTATGG + Intergenic
993543648 5:89184061-89184083 GGGAAAAGAGCTTGGGGTTTTGG - Intergenic
995478198 5:112569176-112569198 GGTTGATGGGGTTGGAGTTCAGG - Intergenic
997426330 5:133805153-133805175 GGGAAATGGGCTGGGAAATGAGG - Intergenic
997831501 5:137154468-137154490 GGGAAATGGCCTTGGAGTGATGG + Intronic
998164055 5:139831916-139831938 GAGAAAAGAGATTGGAGTTCAGG - Intronic
1000690381 5:164311198-164311220 AGAAAATAGGCTTGGAGTTCTGG + Intergenic
1001420092 5:171579496-171579518 GGGTCATGGGCTTTGAGGTCTGG + Intergenic
1001441149 5:171743953-171743975 GGGAACTGGAATTGGGGTTCAGG - Intergenic
1002301902 5:178262145-178262167 GGGAAAGGGGCTTCCAGGTCTGG + Intronic
1002587808 5:180263022-180263044 GAGGAATGAGCCTGGAGTTCAGG - Intronic
1003042941 6:2704652-2704674 GGGAAATGAGGTTAGAGTTAGGG + Intronic
1003507681 6:6752931-6752953 GGGAAAGGTGCTTGGAAGTCAGG + Intergenic
1004608951 6:17220467-17220489 GGGAAAGGGGCTGGGATTTCTGG + Intergenic
1005221448 6:23593269-23593291 AGGAAATGGACTTGGAGATGAGG + Intergenic
1007426315 6:41748523-41748545 GGGAAGTGGGGTGGGAGTTGGGG - Intronic
1007453942 6:41961747-41961769 GGGATGTGGGCTGGGAGTTTGGG - Intronic
1011034662 6:82959955-82959977 GGGAAATACGCTTGCAGTCCCGG + Intronic
1015497419 6:133895798-133895820 GGGAAGTCGGCCTGGAGTTGGGG + Intergenic
1016712195 6:147186476-147186498 GGGAAGTGGCCTGGCAGTTCAGG + Intergenic
1017737846 6:157380684-157380706 GAGAAATGGGCTGGGGGTGCCGG - Intergenic
1018179407 6:161207726-161207748 GGGAAATGGGGATGGAGTGGAGG + Intronic
1019096003 6:169579670-169579692 TGGAAAAGGGGTGGGAGTTCCGG - Intronic
1019930567 7:4220231-4220253 GTGATATTGGCTTGGAGCTCGGG - Exonic
1021216439 7:17921585-17921607 AGGAAATGGGCTGGGAGTTATGG - Intronic
1021637633 7:22707531-22707553 GGGAAATGGGGTTGAATGTCTGG - Intergenic
1022630284 7:32078299-32078321 GAGCACTGGGCTGGGAGTTCAGG - Intronic
1022806988 7:33832204-33832226 TGGAAATGGTCTTTGAGTTTTGG + Intergenic
1026387280 7:69862699-69862721 GGGAGATGGGCTGGTAGATCTGG + Intronic
1026468137 7:70672024-70672046 GTGAACTGGGTTTGGAGTTAGGG + Intronic
1028856016 7:95595526-95595548 GGGACATGGAATTGGAGTTGGGG + Intronic
1029522067 7:101069213-101069235 GGGAAATTGGCTGGGAGTGGTGG - Intergenic
1033045142 7:137955191-137955213 TGGAAATGGGCAAGGATTTCAGG - Intronic
1035362490 7:158322649-158322671 GGGACAAGGCCTTGCAGTTCTGG + Intronic
1035779544 8:2216886-2216908 GGGGAATGGGCTTTGACTTCTGG + Intergenic
1036033126 8:4993656-4993678 GTGAAACAGGCTAGGAGTTCTGG - Intronic
1037330276 8:17737170-17737192 GGGAAATGGGCCGGGTGTTCTGG - Intronic
1037929350 8:22868529-22868551 GGCAGATGGGTTTAGAGTTCAGG - Intronic
1040445016 8:47484604-47484626 GGGAGATGGTCTCGTAGTTCTGG + Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041077855 8:54185630-54185652 GGGAACTGGGCTTGGGGAACTGG - Intergenic
1041171597 8:55147968-55147990 GGGACAGGGGCTGGGACTTCTGG + Intronic
1041524145 8:58787116-58787138 GTCACATGGGCTTGGAGTTAGGG + Intergenic
1042173456 8:66015462-66015484 GGGAGAGCGGCTTGGGGTTCAGG + Intergenic
1044291351 8:90474495-90474517 GTGAATTGGGCTTGGGGTGCTGG - Intergenic
1044321825 8:90810841-90810863 GGGTAAGGGGCATGGTGTTCGGG + Intronic
1045455453 8:102374479-102374501 GGGAATTGTGTTTGGAGTACAGG - Intronic
1047054288 8:121146779-121146801 GAGCAATGGGCTTGGATTGCAGG - Intergenic
1047436653 8:124840437-124840459 AGGAAATGGCCTTGAAGGTCAGG - Intergenic
1048987461 8:139742402-139742424 AGGTCAAGGGCTTGGAGTTCTGG - Intronic
1049057086 8:140245604-140245626 GGGAAAAAGGCATGAAGTTCTGG - Intronic
1049255493 8:141611572-141611594 GAGGAGTGGGCTTGGAGGTCAGG - Intergenic
1049444534 8:142623969-142623991 GGAAACTGGGCTGCGAGTTCAGG + Intergenic
1052741407 9:32396136-32396158 GGGAAATAGGGTTAGACTTCAGG + Intronic
1052779742 9:32768783-32768805 GAGAAATGGGATTAGAGATCTGG - Intergenic
1057291967 9:93812640-93812662 GGGAAAGGGGCAGGCAGTTCTGG - Intergenic
1059867821 9:118536199-118536221 GGGAAATGTGCTTGGACTGAAGG + Intergenic
1061074457 9:128332683-128332705 GGGCACTTGGCTTGGAGTACAGG - Intronic
1061315900 9:129795620-129795642 GGGAGGTGGGCTTGGAGCTGAGG + Intergenic
1061741316 9:132708459-132708481 GGGAGAGGAGCTCGGAGTTCTGG - Intergenic
1062289273 9:135787258-135787280 GGGAAGTGTGCTTGGGCTTCGGG + Intronic
1062581674 9:137231693-137231715 GGGAACTCGGCATGGATTTCGGG - Exonic
1186339442 X:8628266-8628288 GGGAAAAGGGTGGGGAGTTCTGG - Intronic
1186745909 X:12568623-12568645 GGGCAATGGGCCTGGGGTTTGGG + Intronic
1187016919 X:15338358-15338380 GGAAAATGGGCTTGATGTTGAGG + Intergenic
1188244462 X:27823417-27823439 GGCAAATGGGATTGGAGGTTTGG + Intergenic
1188552946 X:31381623-31381645 GGGAAATGGGGTTGAATGTCTGG - Intronic
1190263333 X:48813359-48813381 GGGAAAAGAGCTTGGAATTGGGG - Intronic
1196703714 X:118698482-118698504 GGTAATGGGGCTTGGAGTTGAGG + Intergenic
1201774261 Y:17646510-17646532 GGTAAAAGGGCTTGGGGGTCCGG - Intergenic
1201827296 Y:18259479-18259501 GGTAAAAGGGCTTGGGGGTCCGG + Intergenic