ID: 1122272663

View in Genome Browser
Species Human (GRCh38)
Location 14:100575332-100575354
Sequence AGCGATGCCAGCCCTTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122272663_1122272671 23 Left 1122272663 14:100575332-100575354 CCCTGTGAAGGGCTGGCATCGCT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1122272671 14:100575378-100575400 GGCGGCTGAATCCCTACCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 51
1122272663_1122272673 29 Left 1122272663 14:100575332-100575354 CCCTGTGAAGGGCTGGCATCGCT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1122272673 14:100575384-100575406 TGAATCCCTACCTTGGGCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 177
1122272663_1122272670 22 Left 1122272663 14:100575332-100575354 CCCTGTGAAGGGCTGGCATCGCT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1122272670 14:100575377-100575399 CGGCGGCTGAATCCCTACCTTGG 0: 1
1: 0
2: 0
3: 4
4: 40
1122272663_1122272665 2 Left 1122272663 14:100575332-100575354 CCCTGTGAAGGGCTGGCATCGCT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1122272665 14:100575357-100575379 CTTTATCACCACTATCATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 143
1122272663_1122272666 5 Left 1122272663 14:100575332-100575354 CCCTGTGAAGGGCTGGCATCGCT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1122272666 14:100575360-100575382 TATCACCACTATCATCCCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1122272663_1122272672 28 Left 1122272663 14:100575332-100575354 CCCTGTGAAGGGCTGGCATCGCT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1122272672 14:100575383-100575405 CTGAATCCCTACCTTGGGCCAGG 0: 1
1: 0
2: 5
3: 41
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122272663 Original CRISPR AGCGATGCCAGCCCTTCACA GGG (reversed) Intronic
901537327 1:9891045-9891067 AGCTATGCCAGCTCTTTGCAGGG + Intronic
901627956 1:10634373-10634395 TGGGATTCCAGCCCTTCAGAGGG + Intergenic
902870475 1:19311224-19311246 AGTGATTCCAGCCCTCCACAGGG - Intronic
902927799 1:19708540-19708562 AGCGGGGCCAGCCCTTCCAAAGG + Intronic
906240709 1:44240605-44240627 AGAGATGACAGCCCTTATCACGG + Intronic
909585728 1:77285504-77285526 ACAGATGTCAGCCCTTCAAAGGG + Intronic
910747697 1:90591351-90591373 AGGGAAGCCAGCACTTCACATGG + Intergenic
912017702 1:105061994-105062016 AGGGATGCCAGCACTTTACATGG + Intergenic
919746139 1:201010283-201010305 AGAGGTCCCTGCCCTTCACAAGG - Intronic
920291718 1:204928184-204928206 ATTTAAGCCAGCCCTTCACAGGG + Intronic
920341306 1:205276681-205276703 AGCGATGCCCGCCAGACACAGGG + Intergenic
920533872 1:206724456-206724478 AGCAATGAAAGCCCTTCAGATGG - Intronic
924905261 1:248445424-248445446 AACGATTCCAGTCCTTCACTTGG + Intergenic
924922628 1:248646625-248646647 AACGATTCCAGTCCTTCACTTGG - Intergenic
1065728951 10:28693217-28693239 AACTTTGCCAGCCCTTCACCTGG - Intergenic
1069707698 10:70469083-70469105 AGCGATGCCAGCTCCTCTTAAGG - Intergenic
1070349079 10:75575018-75575040 GGAGGTGCCAGCACTTCACATGG + Intronic
1071166986 10:82818177-82818199 TGCGTTACCACCCCTTCACATGG - Intronic
1075596855 10:123738110-123738132 GGAGGTGCCAGCACTTCACATGG - Intronic
1075647340 10:124105068-124105090 ACAGAAGCCAGCCCTACACATGG - Intergenic
1077101930 11:826248-826270 AGTGATTCCAGCCCTTCAGGTGG + Intronic
1077490335 11:2858134-2858156 AGCGGTGCCAGGCCTTGGCAGGG - Intergenic
1080057674 11:27924485-27924507 AGGGAAGCCAGCACTTCACATGG + Intergenic
1085776361 11:79370200-79370222 ATGGAGGCCAACCCTTCACATGG + Intronic
1087137674 11:94737197-94737219 AGCGTTGCCAGTGCTCCACAGGG - Intronic
1089419060 11:118317250-118317272 AGCCATGCCTCCCCTTGACAGGG - Intergenic
1091122174 11:133065509-133065531 AGCGATGCCCTTCCTACACACGG - Intronic
1096041010 12:48517363-48517385 AGGGGTGCCAGCCCCCCACATGG - Intronic
1100615960 12:96231950-96231972 GGCCATGCCAGCACTTTACACGG - Intronic
1106111041 13:26777159-26777181 AGGGAAGCCAGCACATCACATGG + Intergenic
1115006890 14:28496641-28496663 GGGGAAGCCAGCACTTCACATGG - Intergenic
1115916681 14:38322537-38322559 AGGGGAGCCAGCGCTTCACATGG + Intergenic
1117516128 14:56503347-56503369 AGCAATCCCAGTCCTTAACATGG + Intronic
1120557614 14:85948373-85948395 AGGGAAGCCAGCACTTCACATGG + Intergenic
1121267130 14:92611540-92611562 ATCGCAGCCAGCCCATCACATGG + Intronic
1122272663 14:100575332-100575354 AGCGATGCCAGCCCTTCACAGGG - Intronic
1124476480 15:30039281-30039303 AGTTATGCCAGCTCTTCAGAAGG + Intergenic
1125518402 15:40335473-40335495 AGGGATGCCAGCCCCTCCTAGGG + Exonic
1128372391 15:67049865-67049887 AGGAATGACAGCCCTGCACATGG + Intergenic
1131158908 15:90091709-90091731 AGCCAGGCCCGCCCTTCACCAGG + Intronic
1131939715 15:97547577-97547599 AGGGAAGCCAGCACATCACATGG + Intergenic
1133982892 16:10646781-10646803 AAGGAGGCCAGCCCTTCACCTGG + Intronic
1138379388 16:56589744-56589766 AGGCATGCCCGCCCTTCACGAGG - Intronic
1146514336 17:33477707-33477729 AGGGAAGACAGCCATTCACATGG + Intronic
1147417077 17:40299873-40299895 TGCCATGTCAGCCCTTCAGATGG - Intronic
1151367400 17:73626402-73626424 AGCTATGCCAGCCTGTCCCAGGG + Intronic
1151834363 17:76573387-76573409 CCCGATGCCAGCCCTCCTCATGG - Intronic
1152883190 17:82832052-82832074 ACAGAAGCCAGCCCTCCACAGGG - Exonic
1154210128 18:12372528-12372550 AGCAATGCCATCCCTACCCAAGG + Intronic
1159107040 18:64014482-64014504 AGCGTTCCCAGCCATTCCCAGGG - Intergenic
1159956749 18:74524134-74524156 AGTGATGGCAGGCCATCACAAGG - Intergenic
1168635523 19:57993478-57993500 AGCGATTCCAGCCCCACACTAGG + Intronic
925364718 2:3304099-3304121 GGCGTTTCCAGCCCTTCAGATGG - Intronic
925912463 2:8582762-8582784 ACAGATGCCAGCCATGCACAGGG + Intergenic
925932205 2:8717487-8717509 GGCAATGCCAGCCCTCCACTTGG + Intergenic
926853993 2:17232037-17232059 AGAGGAGCCAGCACTTCACATGG - Intergenic
929960125 2:46490164-46490186 AGAGATGTCAGTCCCTCACAGGG + Intergenic
935123251 2:100200031-100200053 AGGGAAGCCAGCACTTCACATGG - Intergenic
935860012 2:107319428-107319450 GGGGAAGCCAGCACTTCACATGG - Intergenic
936663789 2:114571331-114571353 AGGGAAGCCAGCACTTCACACGG - Intronic
938080513 2:128367609-128367631 AAAGATGCCTGCCCTGCACAGGG + Intergenic
938730636 2:134144314-134144336 AGGGAAGCCAGCACTTCCCATGG + Intronic
939135032 2:138283466-138283488 ACTGATGCCAGCAGTTCACAAGG - Intergenic
939587654 2:144025210-144025232 AGAGATGCCAGCCCCTCTCCTGG - Intronic
942642577 2:178075240-178075262 AGCAATGACAGCCCATCAAAAGG + Intronic
946805196 2:223464349-223464371 GGAGAAGCCAGCACTTCACATGG - Intergenic
948376700 2:237525624-237525646 AGAGAAGGCAGCCCCTCACAAGG + Exonic
948698063 2:239743414-239743436 ACTGATGCCAGCCCATGACAAGG - Intergenic
1169216979 20:3799805-3799827 AGCCAGGCCAGCTCCTCACAGGG + Intronic
1171517842 20:25751576-25751598 AGCAATGCCAGTTCTTCACCTGG - Intergenic
1172893848 20:38285712-38285734 GGGGAAGCCAGCACTTCACATGG - Intronic
1177179917 21:17734096-17734118 AGGGGAGCCAGCGCTTCACATGG + Intergenic
1177930707 21:27279562-27279584 AGTGATTCATGCCCTTCACAAGG + Intergenic
1177961087 21:27667048-27667070 ACGGATGGCAGCTCTTCACAAGG + Intergenic
1178257154 21:31064576-31064598 AGGGATGCCAGCCCTTCTAAAGG - Intergenic
1182408153 22:30156104-30156126 AGCCATGCTCGCCCTCCACATGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183878413 22:40804347-40804369 AGGGATCCCATTCCTTCACAGGG - Intronic
1184466348 22:44670570-44670592 AGAAGTGCCAGCCCTTCTCACGG - Intronic
1184956408 22:47889741-47889763 AGGGGAGCCAGCACTTCACATGG - Intergenic
951191112 3:19772658-19772680 AGGGAAGCCAGAACTTCACATGG - Intergenic
953376505 3:42432760-42432782 AGCGCTGCCACCCTTTCTCACGG + Intergenic
954807373 3:53228429-53228451 AGAGAGGCCATCCCTTCCCATGG + Intronic
955767686 3:62362055-62362077 AGCTATTCCAGCCCTCCGCATGG - Intergenic
962414417 3:135169070-135169092 AGCTATGCCAGGCCATCACATGG + Intronic
962809640 3:138949562-138949584 ACCGATTCCAGCCCTTCCCAGGG - Exonic
963233499 3:142933485-142933507 TGCCAAGCCAGTCCTTCACAAGG + Intergenic
966973528 3:185066269-185066291 GGCGGAGCCAGCACTTCACATGG - Intergenic
969579426 4:8055470-8055492 TGCAGTGCCAGCCCATCACAGGG - Intronic
971226018 4:24752194-24752216 AGCTATGCCAGTCATTCTCACGG + Intergenic
971577199 4:28290708-28290730 ATGGAAGCCAGCACTTCACATGG + Intergenic
975902361 4:79167785-79167807 GGGGAAGCCAGCACTTCACATGG + Intergenic
981050344 4:140303555-140303577 AGCTATGCCAGACATTCCCAAGG - Intronic
987174190 5:15290528-15290550 ATTGATGACAGCCCTTCTCAAGG - Intergenic
991502162 5:67287934-67287956 AGCAATGCAAGCACTTCAGAAGG + Intergenic
1001969233 5:175940084-175940106 AGTGATGCCAACCCTTCATGTGG + Intronic
1002248206 5:177903660-177903682 AGTGATGCCAACCCTTCATGTGG - Intergenic
1003879627 6:10468182-10468204 AGGGTTGCCAACACTTCACATGG - Intergenic
1003909844 6:10733294-10733316 AGTGAAGCCAGACCTTCGCACGG + Intergenic
1004432021 6:15553964-15553986 AGAGACGCCAACCCTACACATGG + Intronic
1017777907 6:157693993-157694015 ATCGGTGCCAGCCCATCCCATGG - Intergenic
1021110653 7:16690915-16690937 AGCGCTGCCATCTCTTCACCTGG + Intronic
1022018216 7:26372516-26372538 AGTGATGACAGCAGTTCACATGG + Exonic
1035426431 7:158778826-158778848 AGTGAAGCCAGCCAGTCACACGG - Intronic
1037678286 8:21071339-21071361 AGACAAGACAGCCCTTCACATGG + Intergenic
1037970648 8:23169359-23169381 AGCGGAGCCAGCACATCACATGG - Intergenic
1039719741 8:40150499-40150521 ATTTATGCCAGCCCTTCATATGG - Intergenic
1041006901 8:53504168-53504190 AGGGATGCCAGCCCTTTGCCTGG - Intergenic
1044140406 8:88644508-88644530 GGGGAAGCCAGCACTTCACATGG + Intergenic
1044727943 8:95208226-95208248 AGAGCTGCCAGCCCTTTCCAGGG + Intergenic
1045295955 8:100871889-100871911 TGCCATTCCAGCCCTTCTCATGG - Intergenic
1048591559 8:135825319-135825341 TGGGAAGCCAGCACTTCACATGG - Intergenic
1049613406 8:143566294-143566316 AGTGGTCCCAGCCCTTCACAAGG + Exonic
1055614075 9:78053214-78053236 AGCTATGCCATCCATTCATAGGG + Intergenic
1056390014 9:86132213-86132235 AGCCATGCCAGTCCATAACAAGG + Intergenic
1062451202 9:136616511-136616533 AGCCAGGCCAGCCCCTCACACGG - Intergenic
1189025501 X:37389521-37389543 AGGGCAGCCAGCACTTCACATGG + Intronic
1191877865 X:65814036-65814058 GGGGAAGCCAGCACTTCACATGG - Intergenic
1192660791 X:73040339-73040361 TGGGAAGCCAGCACTTCACATGG + Intergenic
1194376651 X:93142868-93142890 GGGGAAGCCAGCACTTCACATGG - Intergenic
1197719925 X:129738348-129738370 AGTGATGCCAGCTCTTCCCTTGG - Intergenic
1197837567 X:130711855-130711877 AGCCAGGCCAGCCCTCCAGATGG + Intronic
1197837884 X:130714538-130714560 AATGATGCCACCCTTTCACAGGG + Intronic