ID: 1122272991

View in Genome Browser
Species Human (GRCh38)
Location 14:100576655-100576677
Sequence CAGGGGACACAGATGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 342}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122272976_1122272991 7 Left 1122272976 14:100576625-100576647 CCGGGCAGCCCACGAGGACCCTC 0: 1
1: 0
2: 3
3: 12
4: 208
Right 1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG 0: 1
1: 0
2: 2
3: 51
4: 342
1122272979_1122272991 -2 Left 1122272979 14:100576634-100576656 CCACGAGGACCCTCCCTGGCCCA 0: 1
1: 0
2: 2
3: 33
4: 345
Right 1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG 0: 1
1: 0
2: 2
3: 51
4: 342
1122272978_1122272991 -1 Left 1122272978 14:100576633-100576655 CCCACGAGGACCCTCCCTGGCCC 0: 1
1: 0
2: 1
3: 30
4: 300
Right 1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG 0: 1
1: 0
2: 2
3: 51
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122272991 Original CRISPR CAGGGGACACAGATGGTACA GGG Intronic
900302627 1:1985724-1985746 CAGGGGCCACTGAGGGTCCAGGG - Intronic
900310721 1:2032051-2032073 CAGGGGCCAGAGGTGGAACACGG - Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901165980 1:7221848-7221870 CAGGGGTCACCCATGGCACAAGG - Intronic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902391060 1:16106780-16106802 CAGGGGACAGACAGTGTACAGGG + Intergenic
902664345 1:17927149-17927171 AAGGTCACACAGCTGGTACATGG + Intergenic
904116352 1:28164711-28164733 CAGGGGACACAGCTTGTTCTAGG - Intronic
904390919 1:30185303-30185325 CAGATGCCACAGATGGCACAAGG - Intergenic
904576606 1:31509091-31509113 CATGGGACATAGAGGGTGCAGGG - Intergenic
905248450 1:36630692-36630714 CAGGGAACACAGATGTAAAAGGG - Intergenic
905395952 1:37666681-37666703 GAGGTCACACAGCTGGTACATGG + Intergenic
905413858 1:37791588-37791610 CAGGGGACACAATTGTTTCAGGG + Intergenic
905843278 1:41204137-41204159 AAGGTTACACAGTTGGTACATGG + Intronic
905907217 1:41627113-41627135 CAGGGCATGCAGATGGCACAGGG + Intronic
906733867 1:48105694-48105716 CAGGGGAGATAGCTGGTGCAGGG - Intergenic
907465437 1:54632276-54632298 CAGGGGACAGACATTGTACAGGG - Intronic
908691003 1:66780374-66780396 AAGGGGTGACAGATGGTACCTGG + Intergenic
912876385 1:113364218-113364240 AAGGGGAGAAAGATGGAACAAGG + Intergenic
914767815 1:150654726-150654748 CGGGGGACAGATATTGTACAGGG - Intronic
915160255 1:153914450-153914472 AAGGTCACACAGATGGTAAATGG + Intronic
915334207 1:155131129-155131151 CAGGAGACAGTGATGGTGCAGGG + Intronic
916544584 1:165791378-165791400 CAGGAAATACAGAGGGTACAGGG + Intronic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
917626817 1:176854533-176854555 CAAGGGACATAGAAGCTACAGGG + Intergenic
917799616 1:178558985-178559007 CAGGGGACAGACATTGTACAGGG + Intergenic
917981511 1:180272345-180272367 AAGGGGACAAAGATGGGAGAGGG - Intronic
918045399 1:180938178-180938200 CAAGGGACACAGTGGGAACAGGG - Intronic
918588441 1:186214340-186214362 CAGGGCGCACACATGGTCCAGGG - Intergenic
920194003 1:204213962-204213984 CAGAGGACGCAGCTGGTACATGG + Exonic
921415128 1:214877214-214877236 CAGGGGAGAAAGATGGGAGAAGG + Intergenic
921932493 1:220766040-220766062 CGGGGGTCAGAGATGATACAGGG + Intronic
922744497 1:228036669-228036691 CAGGGGACAGAGAAGCTGCACGG - Intronic
923916704 1:238514527-238514549 CAGGGGTCACAGCTGGTAAAAGG - Intergenic
1063016765 10:2085990-2086012 CATGGCACACAGATGATGCAAGG - Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1064422805 10:15204921-15204943 CATGGAACACAGGTCGTACAGGG + Intergenic
1066046479 10:31599868-31599890 CAGAGAACACACATGGTAAAGGG + Intergenic
1066664164 10:37765865-37765887 AAGGGGTGACAGATGGCACATGG + Intergenic
1068166601 10:53339667-53339689 CAGGGGACAGACATTGTACAGGG + Intergenic
1069071388 10:63993747-63993769 AAGGGGAGAGAGATGATACAGGG - Intergenic
1069152811 10:64986772-64986794 CAGGGGGTACATATGTTACATGG + Intergenic
1070276681 10:75013821-75013843 GAGGTCACACAGCTGGTACATGG + Intronic
1070490524 10:76971627-76971649 CAGAGGAAGCAGGTGGTACAGGG - Intronic
1071341687 10:84654680-84654702 CTGGGGACATAGAGGGTAAAAGG - Intergenic
1074980233 10:118613708-118613730 CAGGGGACAGATATTGTACAGGG + Intergenic
1075419963 10:122293449-122293471 CAGGGGACACACATTGAAGAGGG + Intronic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1076416393 10:130292807-130292829 CAGGGGACAGACATTGTACAGGG - Intergenic
1076760661 10:132604324-132604346 GAGGGGACCCTGATGGCACAGGG - Intronic
1076853578 10:133104679-133104701 CAAGGAACACAGCTGGAACACGG - Intronic
1077400627 11:2354922-2354944 CACAGGACACTGATGGTCCATGG + Intergenic
1077779008 11:5304562-5304584 CAGGGGACACTGATTGTACAGGG - Intronic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1078110659 11:8389203-8389225 CAGGGGACACAGCTGTAAGAGGG + Intergenic
1081442349 11:43094158-43094180 CATGGCACACACATGGTAAAGGG + Intergenic
1081998118 11:47377636-47377658 CAGGGGACAGGGCTGGGACAAGG - Intronic
1082821001 11:57544588-57544610 AAGGTCACACAGCTGGTACATGG - Intronic
1082997537 11:59265660-59265682 CAGGGGACTCTGAAGGGACAAGG - Intergenic
1083523067 11:63334013-63334035 CAGGGGTGACAGATGGCACCTGG - Intronic
1084711063 11:70844040-70844062 TTGGGGACTCAGATGGGACAGGG - Intronic
1085453841 11:76654908-76654930 TAGGGGACACAGAGAGGACAGGG - Intergenic
1086038970 11:82451829-82451851 AAGGTGACACAGCTGGTAAATGG - Intergenic
1088492093 11:110398225-110398247 CAGGGGACAGACATTGTACAGGG - Intergenic
1089823673 11:121251771-121251793 AAGGGAACATAGATAGTACATGG + Intergenic
1089881036 11:121773956-121773978 CAGGGGTCACACATGGCATAAGG + Intergenic
1090084271 11:123637431-123637453 CAAGGCACACAGATGGTAAGAGG - Intronic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091254235 11:134169674-134169696 CATGGGACACAGATGCCACCAGG + Intronic
1092706463 12:11290474-11290496 AAGGGGTCACAGATGGCACCTGG + Intergenic
1092748261 12:11693720-11693742 CTGGGGACAGAGATAGTGCAGGG - Intronic
1094063498 12:26340087-26340109 GAGGGGAGACAGAGGGTCCAGGG - Intronic
1095185795 12:39199178-39199200 CAGGGGACAGACATTGTACTGGG + Intergenic
1095926862 12:47587092-47587114 CACTGGACACGGATGCTACACGG - Intergenic
1096088123 12:48880004-48880026 CAGAAGACACAGGTGATACAGGG - Intergenic
1096585257 12:52615740-52615762 CAGGGGAGAAAGAAGGCACATGG + Intronic
1096780280 12:53987699-53987721 AAGGGCACAGAGAGGGTACAGGG - Intronic
1097159044 12:57032970-57032992 CAGAGCACACAGATAGTGCAAGG - Intronic
1098642654 12:72857310-72857332 CAGGGGTGACAGATGGCACCTGG - Intergenic
1098721201 12:73900532-73900554 CTGGGGACATACATTGTACATGG - Intergenic
1099381561 12:81959710-81959732 CAGGGAAAACATATGGTACTTGG + Intergenic
1099433400 12:82616289-82616311 CAGGGGTCAGAGATTGTACAAGG - Intergenic
1099591650 12:84599127-84599149 AAGGTCACAGAGATGGTACATGG - Intergenic
1100344741 12:93717274-93717296 CAGAGGACACATATGATAAAGGG - Intronic
1100414514 12:94357576-94357598 CAGGGGACAGACATTGTACAGGG - Intronic
1101338261 12:103816508-103816530 CAGTGGACCCTGATGGTAGAAGG - Intronic
1101501405 12:105307760-105307782 CAGGGAACAGACATTGTACAGGG + Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102527674 12:113523634-113523656 CAGCGGCCAGAGATGGTAGAGGG - Intergenic
1102612303 12:114123035-114123057 CAGGGGTCACAGCTGGAAGAGGG + Intergenic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1104071807 12:125352465-125352487 AAGGGCACACAGCTGGTATATGG - Intronic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1105020921 12:132816407-132816429 CGTGGGACTCAGATGGCACACGG + Intronic
1105710849 13:23007573-23007595 CGGGGGACAGACATTGTACAGGG - Intergenic
1105847064 13:24302566-24302588 GAGGGGAGAGAGATGGAACAGGG - Intronic
1106736410 13:32592089-32592111 CAGGATAAGCAGATGGTACAAGG - Intronic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1110152458 13:72271360-72271382 CAGGGGTGACAGATGGCACCTGG - Intergenic
1110459890 13:75733514-75733536 AAGGGGTGACAGATGGTACCTGG - Intronic
1111838298 13:93416730-93416752 CAGTGGACACAGAGAGTAGAAGG - Intronic
1112224608 13:97526213-97526235 CAGATGACAGAGATGTTACAAGG - Intergenic
1113066362 13:106377094-106377116 CAGGGGAGACACATGTGACACGG - Intergenic
1113421131 13:110172203-110172225 AAGGGGACACAGAAAATACAAGG - Intronic
1114049960 14:18914359-18914381 CAGTGGGCACACATGGTCCAGGG + Intergenic
1114112597 14:19487571-19487593 CAGTGGGCACACATGGTCCAGGG - Intergenic
1114859761 14:26501302-26501324 CAGGGGCCACAGAAGATAAAGGG + Intronic
1115505907 14:34093808-34093830 CAGGGGAAATAGCTTGTACAAGG + Intronic
1116238547 14:42312162-42312184 CAGGGGACAGACATTGTACAGGG + Intergenic
1117600324 14:57367303-57367325 CGGGGGACAGACATTGTACAGGG - Intergenic
1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG + Intronic
1121010809 14:90519048-90519070 CAGAAGACACAGAAGGCACAGGG - Intergenic
1121317711 14:92971942-92971964 CCTGGGACACTGATGGAACAAGG + Intronic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1122652941 14:103236020-103236042 CGGGGGACAGACATTGTACAGGG - Intergenic
1125004631 15:34803389-34803411 CAGGGAACACAGAAAGTAGATGG - Intergenic
1125680844 15:41529375-41529397 CAGGGCACACAGAAGGTCAAAGG + Intronic
1125682586 15:41541443-41541465 CAGGGAATAAATATGGTACATGG + Intronic
1127392741 15:58520292-58520314 CAGAGGACACAGAAGTTAAAAGG - Intronic
1127556705 15:60094673-60094695 CAAGGCACACAGATAGTAAATGG - Intergenic
1127899630 15:63331343-63331365 CAGGCATCAAAGATGGTACAGGG + Intronic
1127942477 15:63713463-63713485 CAGGGCACACCGATGGATCACGG + Exonic
1128310640 15:66630023-66630045 CAGGGGGCACAGCTGTTCCAGGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1129262475 15:74376341-74376363 GAGGGGACACAGTGGTTACAAGG - Intergenic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1130112529 15:80977501-80977523 AAGTGGAAACAGAAGGTACAGGG + Exonic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130830625 15:87594887-87594909 CAGGGGACACAGCTCATGCAAGG - Intergenic
1130856418 15:87843443-87843465 GATGGGAAACAGGTGGTACAGGG - Intergenic
1131038130 15:89239005-89239027 CGGGGGACAGACATTGTACAGGG + Intergenic
1131440512 15:92456116-92456138 CAGGGGACAGAGATGATACCTGG + Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131604150 15:93882854-93882876 AAGAGGACACAGAAGGTAAAAGG + Intergenic
1132484678 16:184438-184460 CAGGAGGCAAAGGTGGTACAAGG + Intergenic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1133812370 16:9170503-9170525 CAGGGGACAGAGCTGGTCCTGGG + Intergenic
1134446670 16:14336447-14336469 GAGGGGTCAGAGATGGTACCTGG - Intergenic
1135109544 16:19680118-19680140 AAGGTCACACAGTTGGTACATGG - Intronic
1137540874 16:49360752-49360774 GAGGGCACACAGCTGGCACATGG + Intergenic
1141920374 16:87131810-87131832 GAGGGCCCACAGATGGCACACGG + Intronic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1144909376 17:18668364-18668386 GAAGGGACAGAGAAGGTACAAGG - Intronic
1145219728 17:21078312-21078334 CAGGGGACAGACATTGTACAGGG + Intergenic
1145858306 17:28183984-28184006 CAGGGGACAGAGCAGGTAAATGG - Intronic
1148158710 17:45437748-45437770 AAGGGGACACAGCTGTGACACGG + Exonic
1149572709 17:57684997-57685019 CAGAGGACCCAGATGGTGGAAGG + Intergenic
1150146450 17:62773602-62773624 CAGGGGATCCAGATGGGAAAGGG + Intronic
1150390126 17:64785146-64785168 AAGGGGACACAGCTGTGACACGG + Intergenic
1150613426 17:66751331-66751353 CAGGGCTCACAGATGGCACATGG + Intronic
1150714056 17:67556544-67556566 CAGGGCACACTGATGGGCCAAGG + Intronic
1151133152 17:71919220-71919242 CAGAAAACACTGATGGTACAGGG + Intergenic
1151562445 17:74877935-74877957 CAGGGGGCACAGAGAGAACAGGG - Exonic
1152296366 17:79469497-79469519 CAGGGGACAGGGACGGCACAGGG - Intronic
1152863508 17:82709345-82709367 CAGGGGACAGGGGTGGAACACGG - Intergenic
1153583134 18:6595605-6595627 AAGGTAACACAGATGGTAAATGG + Intergenic
1154301918 18:13201659-13201681 CAGGTCACACAGCTGGTAAATGG - Intergenic
1155390532 18:25330873-25330895 CAGGGGAAAGAGATGACACAAGG + Intronic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1155690683 18:28618621-28618643 CAGGGGGCACAGATGGTTTCAGG + Intergenic
1156032449 18:32728311-32728333 AAGGTCACACAGATGGTAAATGG - Intronic
1156295047 18:35781877-35781899 CAGGGCACAGAGCTGGCACATGG - Intergenic
1156521505 18:37725746-37725768 CAGGTAACACAGCTGGTAAATGG + Intergenic
1157619553 18:49008484-49008506 CAGGGGACCCAGGTGGGGCAGGG - Intergenic
1158422171 18:57304813-57304835 CAGGGGACGCTGATGGTATGGGG - Intergenic
1158606379 18:58900023-58900045 AAGAGGACAGAGATGCTACAAGG - Intronic
1159981425 18:74785898-74785920 CATGGGACACACATGTCACATGG + Intronic
1162283131 19:9716506-9716528 CAGGGGACAGATATTGTACAGGG + Intergenic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162801475 19:13113049-13113071 TAGGGGACAGAGAAGGTACCTGG - Intronic
1162875308 19:13616908-13616930 TAAGGGGAACAGATGGTACAGGG + Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1164024932 19:21343257-21343279 CAGGGGACAGACATTGTACGGGG + Intergenic
1164032106 19:21417002-21417024 CGGGGGACAGACATTGTACAGGG + Intronic
1164261968 19:23575962-23575984 CGGGGGACAGACATTGTACAGGG + Intronic
1165264284 19:34647195-34647217 CAGGGGACACTGAGGTCACAGGG + Intronic
1165866064 19:38939796-38939818 CAGGGGACAGACATTGTACAGGG + Intronic
1166139411 19:40798137-40798159 CAGGGCACACACAGGGTTCATGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1167522152 19:49961318-49961340 CAGGGGACACAGGTGAGTCACGG + Intergenic
1167523229 19:49969407-49969429 CAGGGGACACAGGTGAGTCATGG - Intergenic
1167576665 19:50320956-50320978 CAGGGGGCACAGCTGGGAGAGGG + Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1167917446 19:52753516-52753538 CGGGGGACAGACATTGTACAGGG + Intergenic
1168413671 19:56155684-56155706 GAGGTGACACAGCTGGTTCAGGG + Intronic
926104804 2:10143429-10143451 CAGGGCACTCAGCTGGAACAAGG - Intronic
927477586 2:23425807-23425829 CAGTGCTCACAAATGGTACAAGG - Intronic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
928320971 2:30282554-30282576 CAGGTGACAGAGATGGAGCAAGG + Intronic
928702923 2:33917479-33917501 CAGGGGACAGTCATTGTACAGGG + Intergenic
929667589 2:43845251-43845273 CCAGGGACCCAGATGGGACATGG + Intronic
930183356 2:48386429-48386451 CAGGGGACAGACATTGTACAGGG - Intergenic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930918317 2:56721013-56721035 CAGGGGACAGACATTGTACAGGG - Intergenic
932402157 2:71488486-71488508 CAGGGGGCCCAGATGCAACAAGG + Intronic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
932905938 2:75751269-75751291 CAGGTGATACTGATGGTTCAGGG - Intergenic
933966724 2:87435983-87436005 AAGGGGACACAGAAGTGACAAGG - Intergenic
935402881 2:102679043-102679065 CAGGTGACTCAGGTTGTACATGG + Intronic
935915708 2:107947362-107947384 CAGGGGACAGACATTGTACAAGG + Intergenic
938070193 2:128304365-128304387 CCAGGGACAGAGATGGTGCATGG + Intronic
940301480 2:152180235-152180257 CAGGGGACAGACATTGTACAGGG + Intergenic
940553613 2:155193801-155193823 CAAAGGACACAGCTGGTGCAGGG - Intergenic
941021719 2:160414058-160414080 AATGTGACACAGATGGTAAATGG - Intronic
943062401 2:183052584-183052606 CGGGGGACAGACATTGTACAGGG + Intergenic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
943765678 2:191658997-191659019 TAGGGAACACAGGTAGTACAGGG + Intergenic
944692447 2:202170151-202170173 CAGGGCTCACAAATGGCACAGGG - Intronic
946206644 2:218113734-218113756 CAGGGGACAAACATTGTACAGGG - Intergenic
947105377 2:226663064-226663086 CAGGGAACCCAGGTGGTGCAGGG + Intergenic
947638818 2:231694459-231694481 CAGGGGACAAAGCTGGGACGGGG + Intergenic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948926160 2:241099653-241099675 CAGGGGACTCCTGTGGTACAAGG - Exonic
948957268 2:241303271-241303293 CAGGAGCCCCAGATGGTGCAGGG + Intronic
1168753324 20:298552-298574 GAGGGGCTACAGCTGGTACAAGG + Exonic
1168765979 20:381708-381730 CAGGGGACACCGCCGGGACAGGG + Intronic
1168850745 20:975221-975243 CAGGGGACACTGAGGTTCCAGGG + Intronic
1168881478 20:1209748-1209770 GAGGGGACAGAGATGGAAAAAGG + Intergenic
1168884018 20:1232256-1232278 CAGGAGACACAGATGATGTAGGG + Intronic
1169403684 20:5305251-5305273 CAGGGGACAGACATTGTACAGGG - Intronic
1170192048 20:13654163-13654185 CAGGGCACAGAAATGGTAAAAGG - Intergenic
1171229220 20:23469062-23469084 CAGGGGACAGACATTTTACAGGG - Intergenic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1173595057 20:44253669-44253691 CAGGGGGCAGAGATGGCAGATGG + Intronic
1173735638 20:45359532-45359554 CAGGTGATTCAGATGGCACAGGG + Intergenic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1175324202 20:58111134-58111156 CAGGGGACACTGACAGTCCAGGG - Intergenic
1175418042 20:58814682-58814704 CAAGGGTCACAGCTGGGACATGG - Intergenic
1175626063 20:60489162-60489184 GAGTGGACACAGATGTGACATGG + Intergenic
1175873405 20:62218853-62218875 CAGGGGACACAGATAGTGCTGGG - Intronic
1178056510 21:28805130-28805152 CAGGGCACCCAGATGACACAGGG + Intergenic
1178468528 21:32870946-32870968 CAGAGGACACAGCTGGTAAGTGG - Intergenic
1178881319 21:36452481-36452503 CAGAGGAAACAGATGATTCAGGG - Intergenic
1178995517 21:37395657-37395679 GAGGGGACACAGATAATGCAGGG - Intronic
1179348253 21:40581723-40581745 CAGGGGACACAGGTGTTAGCTGG + Intronic
1180468442 22:15636735-15636757 CAGTGGGCACACATGGTCCAGGG + Intergenic
1181451805 22:23027670-23027692 CAGGGTAAACAGATCTTACATGG - Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1182572994 22:31252873-31252895 TGGGTGACACAGATGGTAAATGG + Intronic
1182626182 22:31648221-31648243 CAGGGGACGCAGCAGGAACATGG + Intronic
1183086863 22:35491910-35491932 CAGGGGACACATCTGGGGCAGGG - Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1185238568 22:49728431-49728453 CAGAGGAAACAGATGTTACAGGG - Intergenic
1185325705 22:50224995-50225017 CAGGGGAGACACATGGTCCAAGG + Intronic
949543356 3:5051464-5051486 CAAGTGACACAGGTGGTAAATGG + Intergenic
949798685 3:7878874-7878896 TAGGGGCCACAGTTGGTAGATGG - Intergenic
951270524 3:20618451-20618473 CGGGGGACAGACATTGTACAGGG + Intergenic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
954683101 3:52356420-52356442 CAGGGAACAAAGAGGATACAGGG - Intronic
956285069 3:67599648-67599670 CAGAGGAAACAGATGGGACGTGG - Intronic
960302501 3:116021005-116021027 TAGGAGACACTGATGGTACTTGG + Intronic
960996369 3:123343099-123343121 CAGGGGACACAGACTTCACAGGG - Intronic
962967130 3:140365622-140365644 AAGGCCACACAGATGGTAAATGG + Intronic
964639745 3:158895868-158895890 CAGTGGACCCAGCTGGTCCATGG - Intergenic
964826163 3:160830223-160830245 CAGGGTCCACAGTTGGTTCAGGG - Intronic
966009291 3:175055514-175055536 CAGGGGGCAGACATTGTACAGGG + Intronic
966978396 3:185106666-185106688 CGGGGGACAGACATTGTACAGGG - Intronic
967826880 3:193884075-193884097 CAGTGGTCACAGATGGCTCACGG - Intergenic
968511332 4:997219-997241 AAGGGGACACAGGTGCTAGAGGG - Intronic
969101259 4:4769900-4769922 AAGGGCACACAGCTGGTACATGG - Intergenic
969225920 4:5798332-5798354 GAGGGGCCATAGATGGTACTGGG + Intronic
969518718 4:7663534-7663556 CAGTGTACACAGAGGGTACGTGG - Intronic
969880805 4:10172414-10172436 CAGGGGACAGGCATTGTACAGGG + Intergenic
971321439 4:25609066-25609088 CAGTGGACACTGATGCTCCAGGG + Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
975887436 4:78982325-78982347 AAGGGGTCACAGATGGCACCTGG - Intergenic
976490765 4:85667386-85667408 CAGGGGTGACAGATGGCACCTGG - Intronic
977642060 4:99368209-99368231 CAGGGGACAGGAATTGTACAGGG - Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
979213432 4:118133613-118133635 CAGGGGGTACAAATGGTATAGGG + Intronic
980490745 4:133524755-133524777 CAGAGGAGAAAGATGGCACACGG + Intergenic
981026950 4:140086269-140086291 CAGGGGACGCTGATGGGGCAGGG - Intronic
981147582 4:141343229-141343251 CAGGGAACACAGATGCTCCAGGG - Intergenic
984812998 4:183811179-183811201 GAGGGGTGATAGATGGTACATGG + Intergenic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
985845197 5:2339380-2339402 CAGGGGTCACAGATCTTACAGGG + Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
987063861 5:14268831-14268853 CCGTGGACACAGATGGCACTGGG - Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
988576745 5:32433192-32433214 CAGTGGACGCAGATGGGAAATGG - Intronic
990306967 5:54503389-54503411 CAGGGGACAGACATTGTACAGGG + Intergenic
991631787 5:68664041-68664063 CATTGGACACAAATGGTAAATGG + Intergenic
993412009 5:87586002-87586024 CAGAGGTCAGAAATGGTACAAGG - Intergenic
993677934 5:90839827-90839849 CAGAGGATACAGGTTGTACAAGG - Intronic
994893673 5:105672212-105672234 CAGGGGGCACATGTGTTACATGG + Intergenic
995309274 5:110692558-110692580 AAGGGGTGACAGATGGCACATGG + Intronic
996291713 5:121859599-121859621 CAGGGGACAGACATTGTATAGGG + Intergenic
1001904839 5:175463085-175463107 CAGGGGACCCAACTGATACATGG - Intergenic
1002001315 5:176197784-176197806 CAGAGGACAGAGGTGGTGCAGGG - Intergenic
1002163480 5:177331145-177331167 CAGGGGACAAAGATGATAACGGG - Intergenic
1002253024 5:177941185-177941207 CAGAGGACAGAGGTGGTGCAGGG + Intergenic
1002321081 5:178376417-178376439 CAGGGACCACAGCTGGGACAGGG + Intronic
1002401157 5:178992194-178992216 CCTGGGACACAGATGGGAGATGG + Intronic
1002500664 5:179645257-179645279 CCTGGCACACAGATGGTACCTGG + Intergenic
1002563491 5:180097747-180097769 CAGGGGACACAGGGGGCTCAGGG + Intergenic
1002660779 5:180790089-180790111 CAGGGTACACAGCTGATACCAGG - Intergenic
1003192078 6:3883116-3883138 CAGGAGGCACAGAAGGCACAGGG - Intergenic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1006038546 6:31234045-31234067 CGGGGGACAGATATTGTACAAGG + Intergenic
1006295800 6:33169503-33169525 CGGAGGACACAGATGGCCCAGGG + Intronic
1007263186 6:40577990-40578012 CAGGGGGCACAGAAGGGACGGGG - Intronic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1007778500 6:44237632-44237654 CCGGGATCACAGCTGGTACAGGG - Intergenic
1009695281 6:67095656-67095678 CAGGGGTGACAGATGGCACCTGG + Intergenic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1009955444 6:70447583-70447605 CGGGGGACAGACATTGTACAGGG + Intronic
1010361791 6:75003938-75003960 AAGGGGTGACAGATGGTACCTGG + Intergenic
1012422131 6:99077234-99077256 AAGGGAACACAGATGATAAATGG + Intergenic
1013285996 6:108682308-108682330 GAAGGGACAGAGAAGGTACAAGG + Exonic
1013430152 6:110048355-110048377 CAGGGGCTACAGAAGTTACATGG - Intergenic
1018594117 6:165460090-165460112 CAGGAGACAGACATTGTACAGGG - Intronic
1018801162 6:167223324-167223346 CAGGGCTCACAGATGGTAAAAGG - Intergenic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1020415854 7:7945023-7945045 CAGGGGACAAAAATGGTAAGAGG - Intronic
1022438015 7:30408713-30408735 CAGGGGGCACTGATGGTACAGGG - Intronic
1022464959 7:30647485-30647507 CAGGGGCCACAGACGCTACTTGG - Intergenic
1022476488 7:30713978-30714000 CAGGGGAGGCAGATGGTATTGGG - Intronic
1022487464 7:30790839-30790861 CAGGTGACACAGTTGGTAGGTGG + Intronic
1022598991 7:31738773-31738795 CAGGTGACACAGGTGGCACCTGG - Intergenic
1023089358 7:36603284-36603306 CAGGGGACCCAGATTGTTGACGG - Intronic
1023254004 7:38294951-38294973 CAGGTCACACAGCTGGTTCATGG - Intergenic
1023804613 7:43863697-43863719 CGGGGGACAGACATTGTACATGG + Intergenic
1024102112 7:46043130-46043152 CAGGGGACAGACATTGTACGGGG + Intergenic
1024911301 7:54450182-54450204 CAGGGGACAGACATTGTACAGGG - Intergenic
1025102442 7:56146871-56146893 CGGGGGACAGACATTGTACAGGG - Intergenic
1025122668 7:56318403-56318425 CAGAGGACAGACATTGTACAGGG - Intergenic
1027225552 7:76241401-76241423 CAGGGGTCTCAGATGGAAAAGGG + Intronic
1028203666 7:87992226-87992248 CAGAGGAAAGAGATGGAACAAGG + Intronic
1028780183 7:94727272-94727294 CAGGGGACAGATATTGTACAGGG + Intergenic
1029515495 7:101020733-101020755 CAGGGTGCACAGCTGGTTCATGG - Intronic
1032191449 7:129768139-129768161 CGGGGGACAAAGATGATGCAAGG + Intergenic
1034054779 7:148022578-148022600 CAGGGCACACTGATGGAACCCGG - Intronic
1034535041 7:151721079-151721101 GAGGGGACACAGAGGGCAGAGGG + Intronic
1034581103 7:152043391-152043413 CGGGGGACAGACATTGTACAGGG + Intronic
1034942753 7:155242161-155242183 CGGGGGACAGACATTGTACAGGG + Intergenic
1035312074 7:157975792-157975814 CAGGGCACACAGTAGGTACCTGG - Intronic
1035936651 8:3848684-3848706 CAGATCACACAGATGGTGCAAGG - Intronic
1038020353 8:23547699-23547721 CAGGGGCCCAACATGGTACATGG - Intronic
1038733633 8:30149864-30149886 CAGGGGACAGACATTGTACGGGG + Intronic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039477057 8:37844618-37844640 CAGTGGAGACAGGGGGTACAGGG + Exonic
1040563055 8:48541504-48541526 CAGGGTACATGGATGGCACATGG - Intergenic
1040956240 8:52982905-52982927 TAGGGGACAGACATTGTACAGGG + Intergenic
1042446467 8:68890658-68890680 CAGGGGACAGACATTGTACAGGG - Intergenic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1042859921 8:73302082-73302104 AAGGGTACAGAAATGGTACATGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044307656 8:90656737-90656759 CAAGAGACACAGAGGGTTCATGG - Intronic
1044442512 8:92238566-92238588 CAGGGGACAGACATTTTACAGGG - Intergenic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1048529616 8:135235477-135235499 ATGGGGGCACAGTTGGTACAGGG - Intergenic
1048686600 8:136911498-136911520 CAGGAGACAGACATTGTACAGGG + Intergenic
1048982864 8:139712472-139712494 CTGGGGACCCAGAAGGTACGTGG - Intergenic
1049204258 8:141356083-141356105 CAGGGGCCACAGCTGGGAAATGG - Intergenic
1049536323 8:143184089-143184111 CAGGGGACACAGGTACTACACGG - Intergenic
1049857617 8:144873058-144873080 CAGAGGACAGACATTGTACAGGG - Intergenic
1051987216 9:23105342-23105364 AAGGGGGGACAGATGGCACATGG + Intergenic
1052464516 9:28813599-28813621 CAGGAGACACACATTGAACAAGG + Intergenic
1052553797 9:29986672-29986694 CAGTGGACACTGATGGGAGAGGG + Intergenic
1053126330 9:35583569-35583591 CAGGGGACAGACATTGTATAGGG - Intergenic
1054826744 9:69581027-69581049 CAGGGGACACAGATCAAAGATGG + Intronic
1054859007 9:69930668-69930690 AAGGGGACATACAGGGTACAAGG + Intergenic
1057285932 9:93754322-93754344 CAGGGGACAGACATTGTACAGGG + Intergenic
1059466719 9:114473401-114473423 CAGGGGACACTGAAGGGACCAGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061510322 9:131057087-131057109 CAGGGGACACAGCTGGCATAGGG - Exonic
1061542366 9:131284394-131284416 CAGGGCCCACAGCTGGTACAAGG - Intergenic
1062068766 9:134543915-134543937 CAGGGGACACAGATGTCGTAGGG + Intergenic
1062125853 9:134861938-134861960 CAGGGGCCACATATGGAACGTGG + Intergenic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1186230233 X:7445796-7445818 CAGGGAACATAGATTGTATAAGG - Intergenic
1186712728 X:12217009-12217031 AAGGGGACACAGGTGGCACCTGG + Intronic
1187579594 X:20593731-20593753 CATGGAACACAGACTGTACACGG - Intergenic
1188266981 X:28088885-28088907 CAAGTGCCACAGATGGGACAGGG - Intergenic
1189042823 X:37560750-37560772 AAGGGGTAACAGATGGCACATGG + Intronic
1189068166 X:37834083-37834105 CAGAGGACAGAGATGGTGAAGGG - Intronic
1189956724 X:46283247-46283269 TAGTGGACTCAGATGGTAAATGG + Intergenic
1190548630 X:51556249-51556271 AAGGGGAGACAGATGGCACCTGG - Intergenic
1191048281 X:56162652-56162674 CAGGGGTGACAGATGGCACCTGG - Intergenic
1191125888 X:56953558-56953580 AAGGGGTGACAGATGGCACATGG - Intergenic
1191149674 X:57207872-57207894 CAGGGGACAGACATTGTACAGGG + Intergenic
1193048726 X:77079190-77079212 CGGGGGACAGACATCGTACAGGG - Intergenic
1193613068 X:83655479-83655501 AAGGGGTGACAGATGGTACCTGG - Intergenic
1194536095 X:95107236-95107258 CAGGGGACAGACATTGTACGGGG + Intergenic
1196535869 X:116843507-116843529 GAAGTCACACAGATGGTACATGG + Intergenic
1197889549 X:131255590-131255612 CAGGAGAAACAGGTGGTATATGG - Intergenic
1198683836 X:139207106-139207128 GAGGTCACACAGCTGGTACATGG + Intronic
1200354632 X:155535187-155535209 CATGGGACAGAGATTGTACATGG + Intronic
1200777450 Y:7182047-7182069 AAGGGGACACACAGGGTTCAAGG + Intergenic