ID: 1122273031

View in Genome Browser
Species Human (GRCh38)
Location 14:100576870-100576892
Sequence CCGGGTGACACAGGTAGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122273031_1122273045 28 Left 1122273031 14:100576870-100576892 CCCGGACTACCTGTGTCACCCGG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1122273045 14:100576921-100576943 TTTCCAACTCCATATAATTGGGG 0: 1
1: 0
2: 1
3: 14
4: 224
1122273031_1122273043 26 Left 1122273031 14:100576870-100576892 CCCGGACTACCTGTGTCACCCGG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1122273043 14:100576919-100576941 AGTTTCCAACTCCATATAATTGG 0: 1
1: 0
2: 1
3: 49
4: 477
1122273031_1122273044 27 Left 1122273031 14:100576870-100576892 CCCGGACTACCTGTGTCACCCGG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1122273044 14:100576920-100576942 GTTTCCAACTCCATATAATTGGG 0: 1
1: 0
2: 0
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122273031 Original CRISPR CCGGGTGACACAGGTAGTCC GGG (reversed) Intronic
900198838 1:1393163-1393185 GTGGGGGACACAGGAAGTCCAGG + Intronic
901478405 1:9506621-9506643 CAGGGGGACACCGTTAGTCCAGG - Intergenic
902606278 1:17571124-17571146 CCAGGTGACCCAGGTGGCCCAGG + Intronic
903344707 1:22676938-22676960 CCGGGTGATCCAGGTGCTCCCGG + Intergenic
905169697 1:36102138-36102160 CTGGGTGACAGAGGGAGACCTGG + Intronic
906642844 1:47451793-47451815 CTGGGTGACACAGCAAGACCCGG - Intergenic
914255307 1:145957722-145957744 CCGGGGGGCAGGGGTAGTCCTGG + Exonic
915302987 1:154962039-154962061 CCGGGAGGCCCAGGTAGCCCGGG + Intronic
916728463 1:167544901-167544923 CCAGGTGACACAGGGAATTCTGG - Intronic
916735261 1:167601833-167601855 CCGGGTGAAACAGGCTGACCTGG + Intergenic
916747211 1:167693766-167693788 CCTGGTGCCACAGGTGCTCCTGG + Intronic
920556497 1:206908324-206908346 CCGGGTGCCACAGGCAGCCTGGG + Intronic
1064650509 10:17504515-17504537 CTGGGTGACACAGTGAGACCTGG + Intergenic
1065316601 10:24470268-24470290 CCGCGTGACACAGGTTTTGCAGG - Intronic
1065499478 10:26365243-26365265 CTGGGTGACAGAGGGAGGCCAGG - Intergenic
1069865212 10:71498159-71498181 CATGGTCACACAGCTAGTCCTGG + Intronic
1072274570 10:93810448-93810470 CTGGGTGACACAGCAAGACCCGG + Intergenic
1073177520 10:101565476-101565498 CAGGGTAACACTGGTAGTCCAGG - Intergenic
1074129670 10:110562835-110562857 CCAGGTGATACATGAAGTCCTGG + Intergenic
1074523995 10:114248948-114248970 CCGGGGGACCCAGGGAGGCCAGG - Intronic
1076462704 10:130657244-130657266 TCAGGGGACACAGGTACTCCGGG + Intergenic
1076486851 10:130826242-130826264 CCAGGTGACACAAGAAGGCCAGG - Intergenic
1077397072 11:2329973-2329995 CCGGGTGATGCAGCTGGTCCAGG - Intergenic
1084857960 11:72000883-72000905 CCAGGTGACAAAGGCAGTGCTGG - Intronic
1084933981 11:72577261-72577283 CAGGGTCACACAGGAAGTCCTGG + Exonic
1085183510 11:74556299-74556321 CTGGGTAACACAGGGAGACCTGG + Intronic
1088091393 11:106044137-106044159 CTGGGTGACACAGTGAGGCCAGG - Intergenic
1091720580 12:2810444-2810466 CTGGGTCCCACAGGTATTCCTGG - Intergenic
1091758400 12:3071415-3071437 CCGGGTGCCGCAGGCAGTCTGGG - Intergenic
1092865837 12:12760299-12760321 CTGGGTGACACAGTGAGACCCGG + Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1104592254 12:130093966-130093988 GCGGGTCACACAGGCAGCCCAGG + Intergenic
1104900200 12:132185749-132185771 CTGGGTGACACAGCAAGACCTGG + Intergenic
1105202905 13:18194758-18194780 CCCGGTGACCCAGGCAGCCCTGG + Intergenic
1107873596 13:44769234-44769256 CTGGGTGACAGAGGGAGACCTGG + Intergenic
1112672911 13:101661397-101661419 CCGGCTTACTCAGGTAGTCTTGG + Intronic
1114066204 14:19061810-19061832 CCCGGTGACCCAGGCAGCCCTGG + Intergenic
1114096064 14:19338214-19338236 CCCGGTGACCCAGGCAGCCCTGG - Intergenic
1119348393 14:73944609-73944631 CCGAGTGCCACAGGCAGTTCCGG - Exonic
1122273031 14:100576870-100576892 CCGGGTGACACAGGTAGTCCGGG - Intronic
1124862691 15:33458404-33458426 GCTGGTGACATAAGTAGTCCTGG - Intronic
1125439313 15:39684916-39684938 CAAGGTCACACAGCTAGTCCAGG + Intronic
1128028568 15:64460566-64460588 CCGGGTGACTCTGGTTGTCCCGG + Intergenic
1132366435 15:101261106-101261128 CCTCGTGACACAGGTAGTTCTGG - Intergenic
1133564898 16:6984277-6984299 CTAGGTCACACAGGTAGTACAGG - Intronic
1133748644 16:8707209-8707231 CTGGGTGACAGAGGGAGACCTGG - Intronic
1136028927 16:27488804-27488826 CTGGGTGACACAGGTCCTCCAGG - Intronic
1137711256 16:50568365-50568387 GCTGGAGACACAGGAAGTCCAGG + Intronic
1139399746 16:66671824-66671846 CTGGGTAACACAGGGAGACCCGG + Intronic
1143205045 17:5135489-5135511 CCAGGTGACACCAGGAGTCCAGG - Intronic
1144637090 17:16917051-16917073 CCGGGTGACAGAGCAAGACCCGG - Intergenic
1144782541 17:17815294-17815316 CCAGGTGACTCAGCTATTCCGGG - Exonic
1144876088 17:18398179-18398201 CCAGGTGACACCAGGAGTCCAGG - Intergenic
1145156140 17:20546241-20546263 CCAGGTGACACCAGGAGTCCAGG + Intergenic
1145760715 17:27424220-27424242 CCAGGTGACACCAGGAGTCCAGG - Intergenic
1146160770 17:30558486-30558508 CCAGGTGACACCAGGAGTCCAGG - Exonic
1146207105 17:30914366-30914388 CCCCATTACACAGGTAGTCCAGG - Intronic
1146843610 17:36170326-36170348 CCAGGTGACACCAGGAGTCCGGG + Intronic
1146855916 17:36258264-36258286 CCAGGTGACACCAGGAGTCCCGG + Intronic
1146864703 17:36330111-36330133 CCAGGTGACACCAGGAGTCCGGG - Intronic
1146871823 17:36382175-36382197 CCAGGTGACACCAGGAGTCCGGG + Intronic
1146879184 17:36433257-36433279 CCAGGTGACACCAGGAGTCCGGG + Intronic
1146883118 17:36454403-36454425 CCAGGTGACACCAGGAGTCCGGG + Intergenic
1147067565 17:37930705-37930727 CCAGGTGACACCAGGAGTCCAGG - Intronic
1147074709 17:37982799-37982821 CCAGGTGACACCAGGAGTCCAGG + Intronic
1147079094 17:38010260-38010282 CCAGGTGACACCAGGAGTCCAGG - Intronic
1147086232 17:38062338-38062360 CCAGGTGACACCAGGAGTCCAGG + Intronic
1147095033 17:38134202-38134224 CCAGGTGACACCAGGAGTCCAGG - Intergenic
1147102178 17:38186303-38186325 CCAGGTGACACCAGGAGTCCAGG + Intergenic
1147400487 17:40177810-40177832 CCGGGGGACCCAGGTATCCCAGG - Intronic
1147955654 17:44132796-44132818 CAGGGTCACACAGGGAGACCTGG - Intergenic
1149846766 17:60012814-60012836 CCAGGTGACACCAGGAGTCCAGG + Intergenic
1150085114 17:62269388-62269410 CCAGGTGACACCAGGAGTCCAGG + Intergenic
1150662380 17:67094295-67094317 CTGGGTGACAGAGGGAGACCTGG + Intronic
1150680193 17:67278321-67278343 CTGGGTGACAGAGGGAGACCTGG + Intergenic
1151401881 17:73861162-73861184 CTGGGTCACACAGGAGGTCCTGG - Intergenic
1152236335 17:79140964-79140986 CTGGGTGACAGAGGCAGCCCGGG + Intronic
1152245139 17:79181558-79181580 CCAGATGTCACAGGTGGTCCTGG + Intronic
1158221772 18:55158390-55158412 ATGGGGGATACAGGTAGTCCTGG + Intergenic
1158705412 18:59788239-59788261 CCGGGTGAGGCAGATACTCCAGG + Intergenic
1159044938 18:63360857-63360879 CTGGGTGACACAGTGAGGCCGGG + Intronic
1159503091 18:69298770-69298792 CTGGGTGACAGAGGTAGACTGGG + Intergenic
1160081333 18:75730338-75730360 CCGGGAGACTCAGGAAATCCTGG - Intergenic
1162014203 19:7835481-7835503 CTGGGTGACAGAGGTAGACTCGG + Intronic
1162834721 19:13308699-13308721 CTGGGTGACACAGTGAGACCCGG - Intronic
1163036786 19:14574274-14574296 ACAGGTCACACAGGTAGCCCTGG - Intergenic
1164149935 19:22542063-22542085 CCGGGTGACAGAGCAAGACCTGG - Intergenic
1164896982 19:31885547-31885569 CCAGGTAGCACAGGTAGTCCAGG - Intergenic
1165896218 19:39142764-39142786 CAGGGTGACACAGGCAGCCAAGG - Intronic
1166456758 19:42948068-42948090 CTGGGTGACAGAGGAAGACCCGG + Intronic
1167438183 19:49491905-49491927 CCAGGTGCCACAGGCAGCCCTGG + Exonic
936234034 2:110728231-110728253 CTGCGTAACACAGATAGTCCAGG + Intergenic
937929612 2:127193818-127193840 CCGGGTCACCCAGGAAGACCTGG - Exonic
938483603 2:131681946-131681968 CCCGGTGACCCAGGCAGCCCTGG + Intergenic
939220374 2:139294149-139294171 CCGTGTGCCACTGGTAATCCTGG + Intergenic
941468736 2:165859614-165859636 CCAGGTGACACAGGTTACCCAGG - Intronic
945266239 2:207894089-207894111 CTGGGTGACAGAGAGAGTCCTGG + Intronic
947645589 2:231736911-231736933 CAAGATGACACAGGTAGTCAGGG + Intronic
947885395 2:233565751-233565773 CAGGGTCACACAGGTAGTTAGGG - Intronic
948071751 2:235133428-235133450 CAGGGTGACAGAGGGAGTCCTGG + Intergenic
1170941875 20:20854701-20854723 TCATGTGACACAGGCAGTCCTGG + Intergenic
1172518563 20:35552870-35552892 ACGTGTGACAGAGGTAGTACAGG + Intronic
1174303929 20:49601841-49601863 CTGGGTGACACAGTAAGACCAGG - Intergenic
1175873406 20:62218854-62218876 CCAGGGGACACAGATAGTGCTGG - Intronic
1176232413 20:64039089-64039111 CCAGGTGCCACAGGAAGTGCGGG - Intronic
1176298467 21:5086898-5086920 CGGGGAGACCCAGGTCGTCCAGG - Intergenic
1176366166 21:6034141-6034163 CTGGGTGACACAGGTTCTGCAGG + Intergenic
1176715052 21:10343247-10343269 CCCGGTGACCCAGGCAGCCCTGG - Intergenic
1179757351 21:43504404-43504426 CTGGGTGACACAGGTTCTGCAGG - Intergenic
1179858559 21:44175051-44175073 CGGGGAGACCCAGGTCGTCCAGG + Intergenic
1180180790 21:46117889-46117911 CCGGGGGAAGCAGGGAGTCCAGG + Exonic
1180484682 22:15784401-15784423 CCCGGTGACCCAGGCAGCCCTGG + Intergenic
1180603296 22:17036691-17036713 CCCGGTGACCCAGGCAGCCCTGG + Intergenic
1180695045 22:17746532-17746554 CCTGGTGACACAGTTAGTGCTGG + Intronic
1181309395 22:21936142-21936164 CTGGGTGACAGAGGGAGACCTGG + Intronic
1182808785 22:33098276-33098298 CTGGGTGACAGAGGAAGACCCGG + Intergenic
1183282145 22:36937683-36937705 CAGGCAGACACAGGTACTCCAGG - Exonic
1183760287 22:39810320-39810342 CCAGGTGACACATGAAGTCTTGG + Intronic
1184609545 22:45594002-45594024 CCAGGTGACATAGGGGGTCCAGG + Intronic
1185259771 22:49854710-49854732 CCGGGTGGCCCTGGTAGACCCGG + Intronic
1185415333 22:50706216-50706238 CCGGGAGACACAGGTGGTACGGG + Intergenic
950526200 3:13525192-13525214 CCGGGTGACAGAGTGAGACCTGG + Intergenic
952927679 3:38333217-38333239 CTGGGTGACACAGTGAGACCTGG + Intergenic
954136271 3:48583563-48583585 CCCGGAGACCCAGGTTGTCCTGG + Exonic
955766678 3:62351404-62351426 CTGGGAGACACAGGTAGACACGG + Intergenic
958037707 3:88189735-88189757 CCTGTTGACCCAGGAAGTCCCGG + Intergenic
966029252 3:175324618-175324640 CCAGGTGTGACAGGTACTCCAGG + Intronic
966208048 3:177424705-177424727 CCTGGTGACACTGGGAGTTCAGG + Intergenic
966374514 3:179281700-179281722 CTGGGTAACACAGGGAGACCTGG + Intergenic
966400686 3:179544180-179544202 CGTGGTGACATATGTAGTCCTGG + Intergenic
967976947 3:195040830-195040852 CCGGGTGACACAGGTGTTGGAGG - Intergenic
968805530 4:2769201-2769223 CAGGGTGTCACAGGGTGTCCAGG + Intergenic
968810644 4:2798297-2798319 CCTGGTGGCACAGGTAGGCCAGG - Intronic
968952561 4:3702454-3702476 CAGAGTGACACAGTCAGTCCGGG - Intergenic
969516069 4:7648870-7648892 CTGAGTGACACAGGATGTCCTGG + Intronic
972618042 4:40719113-40719135 CTGTGTTACACAGGGAGTCCAGG + Intergenic
972650524 4:41013573-41013595 CCGGATGAAACAGGTACCCCTGG - Exonic
980154437 4:129087554-129087576 CTGGGTGACAAAGGGAGACCCGG + Intronic
986372372 5:7092847-7092869 CTGGGTCACACAGCTACTCCTGG + Intergenic
992774784 5:80079940-80079962 CCGTGTGCCACAGGGAGTTCCGG - Exonic
994158878 5:96532998-96533020 CTGGGTGACAGAGGGAGACCTGG + Intronic
999041608 5:148419715-148419737 CTGGGTGACAGAGGGAGACCCGG + Intronic
1004703553 6:18101703-18101725 CTGGGTGACAGAGGGAGACCTGG + Intergenic
1006171500 6:32095903-32095925 GCGGGTGGCACAGGTAGGGCCGG + Intronic
1006701598 6:35978867-35978889 CTGGGTGACACAGCAAGACCTGG - Intronic
1016966331 6:149721582-149721604 CTGGGTGACATAGGGAGACCTGG - Intergenic
1019289387 7:242956-242978 CCGGGTGGCACAGGTATCCCGGG - Intronic
1019289393 7:242974-242996 CCGGGTGGCACAGGTATCCCGGG - Intronic
1019289467 7:243243-243265 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289483 7:243297-243319 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289542 7:243512-243534 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289558 7:243566-243588 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289574 7:243620-243642 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289590 7:243674-243696 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289606 7:243728-243750 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019534921 7:1523857-1523879 CCGGGGGACTCAGGTGGCCCCGG - Intergenic
1027138880 7:75642849-75642871 ACAGGTGAGCCAGGTAGTCCTGG - Intronic
1029940059 7:104470672-104470694 CCAGGTCACACAGGTAGTAAGGG + Intronic
1035072835 7:156157543-156157565 CCGGATGCCACAGGGTGTCCTGG + Intergenic
1039524505 8:38202288-38202310 CTGGGTGACAGAGGGAGACCTGG - Intronic
1041642692 8:60219755-60219777 CTGGTTGACACAGGTAGTAAGGG - Intronic
1048855727 8:138685230-138685252 CCGGGTGGCCCAGGGAGCCCAGG + Exonic
1049540710 8:143207604-143207626 CAGGGAGACACAGTTGGTCCTGG - Intergenic
1050293853 9:4184538-4184560 CTGGGAGACACAGGTAGAACTGG + Intronic
1056826720 9:89880983-89881005 CTGGGTGACCTAGGCAGTCCCGG - Intergenic
1057555822 9:96086881-96086903 CCAGGTGAAAGAGGCAGTCCGGG - Intergenic
1061200813 9:129137530-129137552 CCGGGTTGCCCAGGTAGTCGTGG + Intronic
1061557018 9:131376980-131377002 CTGGGTGACACAGCAAGACCCGG + Intergenic
1062381970 9:136290960-136290982 CCAGGTTTCACAGGCAGTCCAGG + Exonic
1185572079 X:1142408-1142430 CTGGGTGAGACAGTGAGTCCCGG - Intergenic
1194861869 X:99009461-99009483 CCAGGTCACACAGGTAGTAATGG - Intergenic
1195793682 X:108620324-108620346 CCAGGTGAAAGAGGCAGTCCAGG + Exonic
1197610907 X:128637180-128637202 TGGGGTCACCCAGGTAGTCCAGG + Intergenic
1200062235 X:153488764-153488786 CCGGGAGGCACAGGAAGTGCAGG + Intronic
1200067332 X:153510115-153510137 GCTGGGGACACAGGTCGTCCTGG + Intergenic