ID: 1122273212

View in Genome Browser
Species Human (GRCh38)
Location 14:100577669-100577691
Sequence ACAGGCAGCCGGGCTGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 211}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122273212_1122273225 10 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273225 14:100577702-100577724 TCTGGGGAGGAAGGCTGGGCTGG 0: 1
1: 1
2: 14
3: 97
4: 818
1122273212_1122273227 21 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273227 14:100577713-100577735 AGGCTGGGCTGGCGACACCCGGG 0: 1
1: 1
2: 3
3: 25
4: 358
1122273212_1122273222 1 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273222 14:100577693-100577715 TTCAGGGACTCTGGGGAGGAAGG 0: 1
1: 0
2: 2
3: 46
4: 539
1122273212_1122273217 -8 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273217 14:100577684-100577706 CTGCCTGTGTTCAGGGACTCTGG 0: 1
1: 0
2: 2
3: 20
4: 305
1122273212_1122273226 20 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273226 14:100577712-100577734 AAGGCTGGGCTGGCGACACCCGG 0: 1
1: 0
2: 3
3: 15
4: 197
1122273212_1122273224 6 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273224 14:100577698-100577720 GGACTCTGGGGAGGAAGGCTGGG 0: 1
1: 0
2: 4
3: 66
4: 586
1122273212_1122273223 5 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273223 14:100577697-100577719 GGGACTCTGGGGAGGAAGGCTGG 0: 1
1: 0
2: 6
3: 98
4: 789
1122273212_1122273221 -3 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273221 14:100577689-100577711 TGTGTTCAGGGACTCTGGGGAGG 0: 1
1: 0
2: 7
3: 21
4: 295
1122273212_1122273219 -6 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273219 14:100577686-100577708 GCCTGTGTTCAGGGACTCTGGGG 0: 1
1: 0
2: 1
3: 36
4: 256
1122273212_1122273218 -7 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273218 14:100577685-100577707 TGCCTGTGTTCAGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122273212 Original CRISPR ACAGGCAGCCGGGCTGTCAC TGG (reversed) Intronic