ID: 1122273212

View in Genome Browser
Species Human (GRCh38)
Location 14:100577669-100577691
Sequence ACAGGCAGCCGGGCTGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 211}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122273212_1122273217 -8 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273217 14:100577684-100577706 CTGCCTGTGTTCAGGGACTCTGG 0: 1
1: 0
2: 2
3: 20
4: 305
1122273212_1122273226 20 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273226 14:100577712-100577734 AAGGCTGGGCTGGCGACACCCGG 0: 1
1: 0
2: 3
3: 15
4: 197
1122273212_1122273223 5 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273223 14:100577697-100577719 GGGACTCTGGGGAGGAAGGCTGG 0: 1
1: 0
2: 6
3: 98
4: 789
1122273212_1122273221 -3 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273221 14:100577689-100577711 TGTGTTCAGGGACTCTGGGGAGG 0: 1
1: 0
2: 7
3: 21
4: 295
1122273212_1122273222 1 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273222 14:100577693-100577715 TTCAGGGACTCTGGGGAGGAAGG 0: 1
1: 0
2: 2
3: 46
4: 539
1122273212_1122273218 -7 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273218 14:100577685-100577707 TGCCTGTGTTCAGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 238
1122273212_1122273224 6 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273224 14:100577698-100577720 GGACTCTGGGGAGGAAGGCTGGG 0: 1
1: 0
2: 4
3: 66
4: 586
1122273212_1122273225 10 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273225 14:100577702-100577724 TCTGGGGAGGAAGGCTGGGCTGG 0: 1
1: 1
2: 14
3: 97
4: 818
1122273212_1122273219 -6 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273219 14:100577686-100577708 GCCTGTGTTCAGGGACTCTGGGG 0: 1
1: 0
2: 1
3: 36
4: 256
1122273212_1122273227 21 Left 1122273212 14:100577669-100577691 CCAGTGACAGCCCGGCTGCCTGT 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1122273227 14:100577713-100577735 AGGCTGGGCTGGCGACACCCGGG 0: 1
1: 1
2: 3
3: 25
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122273212 Original CRISPR ACAGGCAGCCGGGCTGTCAC TGG (reversed) Intronic
900127186 1:1073797-1073819 ACAGGCTGGCGGGATGACACAGG + Intronic
900867063 1:5276157-5276179 CCAGGCAGCAGGGCTCTCCCTGG + Intergenic
901218396 1:7567566-7567588 CCAGGAAGCTGGGCTGGCACAGG - Intronic
901289664 1:8114058-8114080 ACAGGCAGTCGGGGCGGCACGGG - Intergenic
901878094 1:12178572-12178594 AGATGCACCCGGGTTGTCACAGG + Intronic
903175719 1:21579036-21579058 TCATGCAGCCGGGCTGCCACTGG - Intergenic
904900679 1:33854842-33854864 ACAGGGAGCCTGGCTGTTGCCGG + Intronic
905363918 1:37438543-37438565 ACAGGCACTTGGTCTGTCACAGG + Intergenic
906157132 1:43620309-43620331 ACAAGCAGCTGGGGTGTCAAAGG - Intronic
906697610 1:47834038-47834060 ACCAGCAGCCTGGCAGTCACTGG + Intronic
906713610 1:47951194-47951216 ACAGGCAGGCGGGCAGGCAGGGG + Intronic
907988253 1:59554174-59554196 ACAGCCAGCCGTGACGTCACTGG - Exonic
915237970 1:154499829-154499851 ACAGGCAAACTGACTGTCACAGG + Intronic
918048706 1:180956261-180956283 GCAGGCAGCCTGGCAGCCACAGG - Intergenic
919910457 1:202107539-202107561 ACAGGCAGCCTGGCAGCCCCAGG + Intergenic
920300395 1:204985150-204985172 ACAGGCAGCCTGGGAGACACTGG + Intronic
920705077 1:208244551-208244573 ACAGGCAGCCGAGCGGCCTCCGG - Intergenic
922722008 1:227904135-227904157 GCTGGGAGCCGGGATGTCACAGG - Intergenic
1065033274 10:21610296-21610318 ACTGGCAGCCTGGCCGTCATAGG + Intronic
1067697789 10:48548196-48548218 GCAAGCGGCTGGGCTGTCACGGG - Intronic
1068053895 10:51986034-51986056 CCAGTCAGCCATGCTGTCACCGG - Intronic
1068560892 10:58513152-58513174 CCAGGTAGCCGGGCTCTCCCTGG - Exonic
1073180287 10:101579264-101579286 ACTGGGAGCCGGGCAGACACTGG + Exonic
1073381071 10:103078417-103078439 ACAGGCAGCCTCTCTGGCACAGG - Exonic
1073654098 10:105393662-105393684 ACTGGCAGCCGTCCTGACACAGG - Intergenic
1074843387 10:117375877-117375899 GCTGCCAGCCGGGCTGTCACGGG - Intergenic
1075455068 10:122579713-122579735 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075456132 10:122586195-122586217 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075456623 10:122589079-122589101 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075457183 10:122592407-122592429 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075458764 10:122601932-122601954 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075459395 10:122605991-122606013 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075460027 10:122610050-122610072 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075460659 10:122614109-122614131 GCAGGCAGCTGGGCTGTGGCTGG + Intronic
1075461303 10:122618152-122618174 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075461768 10:122621192-122621214 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075658331 10:124176003-124176025 ACAGGCAGCCCAACTGTCCCAGG + Intergenic
1076069265 10:127473315-127473337 AAAGGCAGTGGGACTGTCACAGG + Intergenic
1076449103 10:130544051-130544073 ACAGTCAGCAGGGCTGCAACAGG + Intergenic
1076851375 10:133095109-133095131 ACAGTTGGCCGGGCTGTCCCTGG + Intronic
1077384331 11:2261886-2261908 ACAGGCTGCAGGGCTGTCGGAGG - Intergenic
1077387434 11:2276870-2276892 ACAGGCAGCGGGGCGGGCACAGG - Intergenic
1081152470 11:39648724-39648746 ACAAGCAGCCGTGGTGGCACTGG - Intergenic
1083341406 11:61960738-61960760 GCAGGCAGCCAGGCCATCACAGG + Intronic
1084662139 11:70552208-70552230 GCAGGCAGCCTGGCTGTACCTGG - Intronic
1087211131 11:95447137-95447159 ACACCCAGCTGGGCTGTGACAGG + Intergenic
1087906056 11:103699380-103699402 ACCGGCAGCCTGGCAGTCAGTGG - Intergenic
1089316299 11:117593488-117593510 ACAGGCTGCCTGTCTGCCACCGG + Intronic
1089977756 11:122747090-122747112 AGAGGCAGCTGGGCTGACAGGGG + Intronic
1091119723 11:133046867-133046889 TAAGGCAGCAGGGGTGTCACTGG - Intronic
1091320257 11:134644577-134644599 ACAGGCAGCTGAGCTGAAACCGG - Intergenic
1092780469 12:11981696-11981718 ACAGTCAGCCAGCCTGACACTGG - Intergenic
1096185979 12:49580838-49580860 ACAGGCAGCAGTGCTGTGAGCGG - Intronic
1096208188 12:49741241-49741263 ACAAGCCGTCGGGCTGTCCCGGG + Intronic
1097734247 12:63164669-63164691 ACAGGGAGTCAAGCTGTCACAGG + Intergenic
1102816199 12:115868431-115868453 ACTGGCAGCTGGGAGGTCACAGG - Intergenic
1104963247 12:132498044-132498066 GCAGCCAGCCAGGCTGTGACGGG - Intronic
1106135019 13:26967511-26967533 GAAGGCAGCCGGGCTGGCGCTGG + Intergenic
1106437399 13:29735621-29735643 ACAGGCACCCTGTCTATCACAGG + Intergenic
1111305028 13:86399767-86399789 TCAGGCAGTCAGGCAGTCACAGG - Intergenic
1113234756 13:108259323-108259345 CCAGCCAGCCTGGCTGTCAGAGG - Intronic
1113533867 13:111049084-111049106 ACATGCAGCAGGGCCCTCACTGG - Intergenic
1113879833 13:113618590-113618612 AGCGGCAGCCTGGCTGCCACTGG + Intronic
1113919822 13:113900855-113900877 ACAGACAGTGGGCCTGTCACCGG - Intergenic
1119401372 14:74364893-74364915 ACAGGTAACCTGGGTGTCACTGG - Intergenic
1119910378 14:78344546-78344568 ACAGAAAGCCGGGCTACCACTGG + Intronic
1122111115 14:99503197-99503219 ACAGGCAGCAGGGCTGGAGCCGG - Exonic
1122273212 14:100577669-100577691 ACAGGCAGCCGGGCTGTCACTGG - Intronic
1122799825 14:104223946-104223968 GCAGGCAGCCGGGCCCTCCCAGG - Intergenic
1124214002 15:27791541-27791563 ACACGCAGCAGGTCTATCACTGG - Intronic
1124249438 15:28097283-28097305 GCAGGCAGCCGGCTTGTCGCGGG - Intronic
1126823855 15:52529729-52529751 AGAGGCACCTGGGCTGTCCCCGG - Intergenic
1132893100 16:2214195-2214217 GCAGGCAGCCGGGCTGCTGCAGG + Exonic
1134084935 16:11349762-11349784 GCAGGCAGCAGGGCTGGCACCGG + Intronic
1134833671 16:17344204-17344226 ACAGGCACCCGGCCTGGGACAGG - Intronic
1136110595 16:28062217-28062239 GCAGACAGCCGGGCTGTGGCAGG - Intronic
1138451934 16:57098274-57098296 ACAGGCAGCCAGGCCATTACGGG - Intronic
1138970502 16:62137074-62137096 CCAGGGAGCCTGGCTGACACAGG - Intergenic
1139276512 16:65732794-65732816 ACAGGCAGTCAAGCTGGCACTGG + Intergenic
1140824206 16:78690704-78690726 ACATGCATCCAGGCTGTGACTGG - Intronic
1141280681 16:82627650-82627672 GCGGGCAGCCGGGCTGTACCAGG - Intronic
1142198586 16:88750483-88750505 ACAGGCAGGAGGGCAGACACGGG - Intronic
1142683340 17:1562637-1562659 ACAGGCAGCCGGGCCGGGCCGGG - Exonic
1142744414 17:1948549-1948571 ACAGGCAGACAGGCAGACACAGG + Intronic
1142744417 17:1948567-1948589 ACAGGCAGACAGGCGGACACAGG + Intronic
1142744421 17:1948585-1948607 ACAGGCGGACGGGCAGACACAGG + Intronic
1143577637 17:7803918-7803940 ACAGGCAGGTGGGCTGGCCCAGG - Intronic
1146016925 17:29241300-29241322 AAAGGCAGCAGGGCAGGCACTGG - Intergenic
1146626484 17:34439129-34439151 ACTGGCGGCAGGGCTGTCCCTGG - Intergenic
1147571215 17:41572174-41572196 GGAGGCAGCCGGGCTGCCCCAGG + Intergenic
1150508210 17:65720537-65720559 AGAGGCAGCAAGGATGTCACTGG + Intronic
1150635532 17:66910802-66910824 GCTTGCACCCGGGCTGTCACGGG + Intergenic
1151288456 17:73131037-73131059 CCAGGCAGCAGAGCTCTCACGGG - Intergenic
1151539380 17:74757465-74757487 ACAGGGGGCTTGGCTGTCACTGG - Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1156337319 18:36183325-36183347 GCAGGCAGCCCTGCTGTCAGAGG - Intergenic
1160225176 18:77006500-77006522 ACAGGCAGGCGGGCAGGCAGGGG + Intronic
1160817406 19:1042491-1042513 CCAGGCATCCAGGCTGTCCCTGG + Intronic
1160823627 19:1069324-1069346 GCAGGAAGCAGGGCTGTCAGCGG - Intronic
1161001290 19:1912474-1912496 AGAGGCGGCCGGGCGGGCACGGG - Exonic
1161068547 19:2249646-2249668 CAAGGCAGCCTGCCTGTCACCGG - Exonic
1161311298 19:3595617-3595639 ACAGGCAGATGGGCTGTCCGAGG + Intronic
1163569674 19:18073498-18073520 GCAGGTAACGGGGCTGTCACAGG - Exonic
1163701454 19:18788711-18788733 CCACGAAGCCGGGCTGGCACGGG + Exonic
1165826886 19:38710622-38710644 ACATACAGCAGGCCTGTCACAGG + Intronic
1166130251 19:40741816-40741838 ACAGGTAGAGGGGCTGGCACAGG + Exonic
1167049704 19:47070917-47070939 AGAGGCAGCAGGGCGGCCACTGG - Intronic
1167698118 19:51026637-51026659 CCAGGCAGGCGGGCTGGCAGGGG + Intronic
925053404 2:834799-834821 ACAGGCAGCCTGGCTATCTTCGG - Intergenic
925566083 2:5256091-5256113 AAATGGAACCGGGCTGTCACAGG - Intergenic
926629492 2:15123671-15123693 ACAGGGAGCCAGCATGTCACAGG - Intergenic
928125258 2:28611131-28611153 ACAGGCAGCCGGGGTGCCTCAGG - Intronic
928887743 2:36169407-36169429 ACAGGGAGCCTGGCTGTAAAGGG - Intergenic
932347696 2:71006411-71006433 ACAGGCAGTATGGCTGCCACAGG - Intergenic
934777413 2:96948296-96948318 ACAGGCAGCAGGACAATCACAGG + Intronic
934954932 2:98609132-98609154 ACGGGCAGCCGGGCAGTGGCCGG + Intronic
936018874 2:108979844-108979866 ACAGCCAGCCTGGCTCTGACGGG + Intronic
937066793 2:119023718-119023740 ATAGGCAGCTGGGGTGTGACTGG - Intergenic
937291722 2:120785903-120785925 TGATGCAGCGGGGCTGTCACTGG - Intronic
937908615 2:127064688-127064710 CCAGGCAGCTGGGCTGTGCCTGG + Intronic
938811747 2:134860329-134860351 ACAGTCAACCAGGCAGTCACAGG - Intronic
938949963 2:136246271-136246293 ACAGGCAGCGGGGCAGACAGGGG + Intergenic
939895759 2:147789508-147789530 ACAGGTAGGGTGGCTGTCACAGG + Intergenic
943693093 2:190889688-190889710 AAAGGCAGTCTGGCTGTCTCGGG - Intronic
944655681 2:201874602-201874624 ACAAGCAGCCGAAGTGTCACTGG + Intronic
946162124 2:217841689-217841711 ATAGGCAGCAGGCCTGTCCCTGG + Intronic
948149333 2:235732776-235732798 ACAGGAAGCAGGGCGGTCACGGG - Intronic
948855970 2:240730799-240730821 ACAGGCAGCCCATCTGTCTCTGG + Intronic
949026977 2:241770864-241770886 GCTGGCAGCAGGGCTGTCATGGG - Intergenic
1168940398 20:1706676-1706698 ACAAGCAGCCCGGCTCTCAAAGG + Intergenic
1169119162 20:3084912-3084934 ACGGGCCGCCAGGCTGTCATGGG + Intergenic
1171292993 20:23993402-23993424 ACAGGCAGAAGGGTTGACACTGG - Intergenic
1172333082 20:34089764-34089786 ACCGGCTTCCAGGCTGTCACGGG - Exonic
1172750008 20:37244167-37244189 CCAAGCAGCCAGGGTGTCACTGG + Intergenic
1173214768 20:41070716-41070738 ACAGGTAGCTGGGCTGTTAGTGG + Intronic
1175334120 20:58184073-58184095 ACAGGCAGCCTGGGTGTCCCTGG - Intergenic
1175539683 20:59740791-59740813 CCAGGCAGGCCGCCTGTCACTGG + Intronic
1178750563 21:35298845-35298867 ACAGTCACAGGGGCTGTCACAGG - Intronic
1180824051 22:18851117-18851139 ACAGGCAGAAGGGTTGACACTGG - Intronic
1181124477 22:20694271-20694293 ACAGGCAGAAGGGTTGACACTGG - Intergenic
1181188686 22:21123431-21123453 ACAGGCAGAAGGGTTGACACTGG + Intergenic
1181210513 22:21287062-21287084 ACAGGCAGAAGGGTTGACACTGG - Intergenic
1181374696 22:22447652-22447674 ACAGTCAGCCAGCCAGTCACTGG - Intergenic
1181398998 22:22639829-22639851 ACAGGCAGAAGGGTTGACACTGG + Intergenic
1181501728 22:23319175-23319197 ACAGGCAGAAGGGTTGACACTGG + Intergenic
1181650422 22:24256230-24256252 ACAGGCAGAAGGGTTGACACTGG - Intergenic
1181706958 22:24654508-24654530 ACAGGCAGAAGGGTTGACACTGG + Intergenic
1181863010 22:25833945-25833967 ACAGTCAGCTGGGCTTACACAGG - Intronic
1182802795 22:33045260-33045282 ACAGCCAGGTGTGCTGTCACAGG - Intronic
1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG + Exonic
1184781227 22:46650651-46650673 ACAACCAGCCTGGCTGTCCCAGG + Intronic
1203216434 22_KI270731v1_random:8368-8390 ACAGGCAGAAGGGTTGACACTGG + Intergenic
1203274192 22_KI270734v1_random:77021-77043 ACAGGCAGAAGGGTTGACACTGG - Intergenic
953160362 3:40414145-40414167 ACAGTCATCATGGCTGTCACTGG - Intronic
954574769 3:51669945-51669967 ACAGGCAGCTGGCCCCTCACAGG - Intronic
954756840 3:52845314-52845336 AGGGGCAGCCCCGCTGTCACTGG - Intronic
961377854 3:126478784-126478806 ACAGACAGACAGGCTGTCAGGGG - Intergenic
962851388 3:139310818-139310840 ACTGGGAGGCGGGCTGGCACCGG + Intronic
964722660 3:159782836-159782858 ACAGGCAGCCTTGCTGTGATGGG + Intronic
968445683 4:651023-651045 AACGGCAGTGGGGCTGTCACAGG + Intronic
968445693 4:651071-651093 AACGGCAGTGGGGCTGTCACAGG + Intronic
968446372 4:654268-654290 ACAGGCACCCGGGGTCCCACCGG - Intronic
968504485 4:965587-965609 ACAGGCGGAGGGGCTGTCCCTGG - Intronic
968521922 4:1037967-1037989 ACAGGAAGTAGGCCTGTCACGGG - Intergenic
969322366 4:6420387-6420409 GCAGGCAGCCAGGATCTCACAGG + Intronic
989331025 5:40258458-40258480 ACTGGCAGCCTGGCTGCAACTGG - Intergenic
990376353 5:55174094-55174116 ACAGGCTGCCAGGCTGTCAGAGG - Intergenic
995046587 5:107656008-107656030 ACGGGCAGCTGGGCTGTCCCTGG - Intronic
999438915 5:151586150-151586172 ACAGGCAGCAGCTCTGACACTGG + Intergenic
1002940542 6:1711706-1711728 GCAGGCAGCCGGGGTGTCAGAGG - Intronic
1004191764 6:13470381-13470403 AGAGGCAGCCTGGCTTTCCCTGG - Intronic
1004612381 6:17255800-17255822 AAAAGCAGCCCGGCAGTCACTGG - Intergenic
1006187013 6:32187212-32187234 ACAGTCAGCCGGGGTGACAGTGG + Intronic
1013232267 6:108169206-108169228 ACAGGCAACCGGGCTGGGGCGGG - Intronic
1017503397 6:155046028-155046050 GCAGGCAGTGGGGCAGTCACAGG - Intronic
1017740367 6:157400841-157400863 ACAGGGAGCCCGGCACTCACTGG - Intronic
1018616501 6:165691786-165691808 ACACGCAGCCAGGCTGCCTCAGG - Intronic
1019481841 7:1270493-1270515 CCAGGCAGCCCGGATGCCACTGG - Intergenic
1022415576 7:30173873-30173895 ACAGAGAGCTGGGCTGTCTCAGG + Intergenic
1024977976 7:55131220-55131242 ACAGGCAGCTGCACTGTTACTGG - Intronic
1028534240 7:91874118-91874140 GCAGGCAGCCGGTTTGTCATTGG - Exonic
1031938008 7:127755726-127755748 ACAGGGAGCCGGTCTGAAACCGG - Intronic
1034265613 7:149779284-149779306 GCAGGCAGCCGGGCTTTCTGTGG - Intergenic
1034447036 7:151119027-151119049 AAATGCAACCAGGCTGTCACTGG - Intronic
1034489784 7:151387073-151387095 ACAGGGAGCCTGGCTGGCTCTGG - Intronic
1034562427 7:151889690-151889712 GCAGGCAGCAGGGCTGGCAGAGG + Intergenic
1034896942 7:154882202-154882224 ACAGGCAGCCGAGGTGCCAAAGG + Intronic
1036167209 8:6447097-6447119 ACAGACAGACGGGAAGTCACTGG + Intronic
1036999599 8:13702854-13702876 ACATGCAGCTGAGCTGTCATTGG + Intergenic
1038515995 8:28188172-28188194 ACAGACAGCCGGGCTGTTTGAGG + Intronic
1040110921 8:43566905-43566927 ACAGGCGGCCAGGCTTTCAGGGG - Intergenic
1040112113 8:43571184-43571206 ACAGGCAACCAGGCCTTCACGGG - Intergenic
1040620880 8:49091167-49091189 ACTAGTAGCCTGGCTGTCACTGG - Intergenic
1040866828 8:52055892-52055914 ACAGACAGCCTGGATGTCAGGGG + Intergenic
1042796159 8:72665416-72665438 ACAAGCAGCAGGTCTGTGACAGG - Intronic
1044617594 8:94158087-94158109 ACAGAGAGCTGGGATGTCACAGG + Intronic
1045554016 8:103197712-103197734 ACGGGCAGCCAGCGTGTCACAGG + Intronic
1047409411 8:124611937-124611959 ACAGGCAGCAGAGCTGTCCCTGG - Intronic
1049444077 8:142622075-142622097 GCTGGCAGCCTGGCTGGCACTGG - Intergenic
1051608041 9:18935851-18935873 ACAAGCAGCTGTGCTGTCAGTGG - Intronic
1056243481 9:84670717-84670739 ACAGGCACTCGGGCTGGCACTGG + Exonic
1056888993 9:90471654-90471676 ACAGGCAGACCTGCTGTCTCTGG - Intergenic
1059353318 9:113681285-113681307 ACAGGCAACCTGACTGTCATAGG + Intergenic
1060860322 9:126948690-126948712 ACAGGCAGCCATCCTGTGACAGG - Intronic
1060911949 9:127358195-127358217 CCTGGCAGCCTGTCTGTCACTGG + Intronic
1062376551 9:136264353-136264375 ACACGCAGCCTGGCTGTGGCTGG + Intergenic
1185698784 X:2214779-2214801 ACAGGCAGCAGGTCTGAAACTGG - Intergenic
1190597083 X:52061231-52061253 ACAGGCCGCCGTTCCGTCACAGG + Intergenic
1190611741 X:52192842-52192864 ACAGGCCGCCGTTCCGTCACAGG - Intergenic
1190916584 X:54815642-54815664 ACAGGCACCAGAGCTGCCACTGG - Exonic
1191253186 X:58268931-58268953 ACAGGAAGCCAGGCTTTCAGGGG - Intergenic
1191253914 X:58271711-58271733 ACAGGCGGCCAGGCTTTCACGGG - Intergenic
1191253957 X:58271863-58271885 ACAGGCGGCCAGGCTTTCAGGGG - Intergenic
1191255815 X:58279133-58279155 ACAGGCGGCCAGGCTTTCACAGG - Intergenic
1191256008 X:58279935-58279957 ACAGGCAGCCAGGCTTTCAGGGG - Intergenic
1191256639 X:58282370-58282392 ACAGGCAGACAGGCTTTCAGGGG - Intergenic
1191256901 X:58283424-58283446 ACAGGCGGCCAGGCTTTCATGGG - Intergenic
1191257246 X:58284955-58284977 ACAGGCGGACAGGCTTTCACGGG - Intergenic
1191257460 X:58285821-58285843 ACAGACAGCCAGGCTTTCAAGGG - Intergenic
1191257572 X:58286257-58286279 ACAGGCGGCCAGGCTTTCAGGGG - Intergenic
1191257626 X:58286475-58286497 AAAGGCAGCCAGGCTTTCAGAGG - Intergenic
1199504131 X:148542653-148542675 ACAGGCTGAAGGGCTGTCAGGGG + Intronic
1199833196 X:151563748-151563770 CCAGGCTCCCGGGCTCTCACCGG + Exonic
1200002816 X:153071051-153071073 ACAGGCATGCGGGATGCCACTGG + Intergenic
1200004907 X:153078958-153078980 ACAGGCATGCGGGATGCCACTGG - Intergenic
1200250614 X:154551956-154551978 AAAGGCAGCAGGGGAGTCACAGG - Intronic
1201017591 Y:9622207-9622229 TGGGGCAGCGGGGCTGTCACAGG - Intergenic