ID: 1122273896

View in Genome Browser
Species Human (GRCh38)
Location 14:100581371-100581393
Sequence TGAGGCTCTAAGGATGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122273889_1122273896 3 Left 1122273889 14:100581345-100581367 CCTGCTGGCTCTCAGGCGCCTGG 0: 1
1: 0
2: 1
3: 34
4: 361
Right 1122273896 14:100581371-100581393 TGAGGCTCTAAGGATGCTGCCGG 0: 1
1: 0
2: 0
3: 21
4: 164
1122273886_1122273896 18 Left 1122273886 14:100581330-100581352 CCGTTGTCATAACAACCTGCTGG 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1122273896 14:100581371-100581393 TGAGGCTCTAAGGATGCTGCCGG 0: 1
1: 0
2: 0
3: 21
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122273896 Original CRISPR TGAGGCTCTAAGGATGCTGC CGG Intronic
900343333 1:2199029-2199051 TGAGGCTGTGAGGAGGCTGTCGG - Intronic
900555756 1:3279588-3279610 AGAGGCTCTGAGGAAGGTGCCGG + Intronic
900774459 1:4571809-4571831 TGAGATGCTCAGGATGCTGCAGG + Intergenic
900878688 1:5364977-5364999 TGAGACTAGAAGGATGGTGCTGG - Intergenic
901185841 1:7372703-7372725 TGGGGCTCCAAGGCTGCTGTGGG - Intronic
902276813 1:15345873-15345895 GGAGGCTTTTAGGATGCTGGTGG - Intronic
902669113 1:17960235-17960257 TGAGGCTTTGGGGCTGCTGCTGG + Intergenic
902720131 1:18298498-18298520 TGTGGCTTTCAGGATGCTTCAGG - Intronic
902755496 1:18546732-18546754 TGAGGACCTGTGGATGCTGCAGG - Intergenic
902942695 1:19812042-19812064 TGAGACTCTAATGTTCCTGCTGG + Intergenic
903000881 1:20264824-20264846 TCAGGCGATATGGATGCTGCGGG - Intergenic
903193198 1:21668181-21668203 TGAGGCTCTCAGGAGGCTCCTGG - Intronic
904455583 1:30646132-30646154 TGAGGCTGGAAAGATGCTGGAGG + Intergenic
906442160 1:45857558-45857580 TGAGTCTCTGAGACTGCTGCAGG + Intronic
906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG + Intergenic
907758772 1:57337447-57337469 AAAGGCTCCAAGGAGGCTGCAGG - Intronic
908961890 1:69708130-69708152 TGTGGCTTTAAGGGTGCTGATGG - Intronic
909164419 1:72200362-72200384 TGAAGCTCCATGGATGTTGCTGG + Intronic
909867618 1:80694141-80694163 TTAGGCATTAAGAATGCTGCAGG + Intergenic
914394318 1:147250521-147250543 TGAGTCTCTACTGATCCTGCAGG + Intronic
916115892 1:161484836-161484858 TGGGGCTATAAGGATGCTGGTGG + Intergenic
919799845 1:201347050-201347072 CAAGGCTCTTTGGATGCTGCAGG - Intergenic
920413838 1:205784280-205784302 TGAGCCTCTGAGGATGCAGCTGG + Intergenic
923171605 1:231422088-231422110 TGAGGCGCTGAGGCGGCTGCCGG - Exonic
1071722642 10:88162993-88163015 TGAGGATGTGAGAATGCTGCTGG - Intergenic
1072812967 10:98477857-98477879 TGAGAATCTGATGATGCTGCTGG - Intronic
1073139276 10:101236919-101236941 TGAGGCGCCAGGGAAGCTGCAGG + Intergenic
1074344822 10:112674607-112674629 TAAGGCTCAAAGAATGCAGCTGG - Intronic
1074423768 10:113332589-113332611 TGACGTTTTAATGATGCTGCCGG + Intergenic
1076307514 10:129475403-129475425 TGAGGCACGGCGGATGCTGCGGG + Intronic
1077177718 11:1198176-1198198 TGAGGCGCCCAGGAGGCTGCAGG + Intronic
1078761739 11:14257262-14257284 TAAGGCTCTTAGAATGGTGCTGG + Intronic
1084068225 11:66717803-66717825 TAAGGATCTAGGGATGCTGTGGG - Intronic
1087852338 11:103046515-103046537 TGAGAATCTAATGCTGCTGCTGG - Intergenic
1089779943 11:120866611-120866633 TGAGGCTCTCTTGGTGCTGCCGG + Intronic
1089875989 11:121722745-121722767 TGAGGCTCTCAGGAAGCGGCGGG + Intergenic
1090774470 11:129950990-129951012 CCAGCCTCTAAAGATGCTGCTGG - Intronic
1091482193 12:844536-844558 TTAGTTTCTAAGGATGCCGCAGG + Intronic
1091980668 12:4861372-4861394 TGAGGCTCTCAGGAAGATGACGG - Intergenic
1092391400 12:8083160-8083182 TGAGGTTCTGAGGATGCTATAGG + Intronic
1092885007 12:12917187-12917209 GGATGTTCCAAGGATGCTGCTGG + Exonic
1096808172 12:54153142-54153164 TCAGGCTCTCTGGAGGCTGCTGG - Intergenic
1097263672 12:57733970-57733992 GGAGGCCCTAAGGAGGCTACTGG - Intronic
1097493778 12:60301954-60301976 TGAGGCACTAAGTATGTTACTGG - Intergenic
1099783577 12:87232053-87232075 TAAGGCTCTAAGGATTCTCTTGG + Intergenic
1099881180 12:88468363-88468385 TGATGCTATAAGTATGCTCCAGG + Intergenic
1100103402 12:91138461-91138483 TGGGGCTCTAAGCCTGGTGCAGG - Intergenic
1104680310 12:130746603-130746625 TGAGAATCTAATGCTGCTGCTGG + Intergenic
1105236871 13:18564904-18564926 TGTGGCTCTCAGGAAGCTTCAGG - Intergenic
1107060257 13:36152767-36152789 TCAGGCCCTAAGGATGCTGTTGG - Intergenic
1107797204 13:44064993-44065015 TGAGAATCTAAGGCTGCTGCTGG + Intergenic
1116290106 14:43023756-43023778 TGGAGCTCCAAGGATGCTTCCGG + Intergenic
1117013355 14:51493044-51493066 TGAGACTCAGAAGATGCTGCTGG + Intronic
1119343701 14:73903599-73903621 TGAGGCTCCAAGGCTGAGGCAGG - Intronic
1122273896 14:100581371-100581393 TGAGGCTCTAAGGATGCTGCCGG + Intronic
1122470251 14:101961477-101961499 TGGGGCTGTCAGGGTGCTGCTGG - Intergenic
1122764256 14:104054657-104054679 TGAGGCTCCAAGGAGGCAGCAGG + Intergenic
1125733721 15:41909228-41909250 TGGGGCTCTGCGGACGCTGCTGG - Intronic
1126557434 15:50004603-50004625 TGAAGCTCTTAGGATGGTGCTGG - Intronic
1129233035 15:74207250-74207272 TGAGGTTCTGGGGATGCTGCTGG - Intronic
1129453526 15:75663877-75663899 TGTGGCTTTGAGGATGCAGCCGG - Intergenic
1130066571 15:80609620-80609642 GGAGGCTTTCAGGATGCTGAGGG + Intergenic
1134118236 16:11565526-11565548 TGAGCCTCTAAGTTGGCTGCTGG + Intronic
1134349367 16:13422208-13422230 TGAGGCTCCAAGGATGTAACAGG + Intergenic
1138508176 16:57489405-57489427 TGAGAATCTAATGCTGCTGCTGG + Intergenic
1141413892 16:83855304-83855326 TGAGGCTCTGTGGATCCTCCAGG - Intergenic
1142299986 16:89251415-89251437 TGAGGATGTACAGATGCTGCGGG - Intergenic
1142406331 16:89892277-89892299 TGAGGGTCTGCAGATGCTGCTGG + Intronic
1143702941 17:8675037-8675059 TCAGGCTCGAACTATGCTGCAGG + Intergenic
1146626853 17:34441588-34441610 TAGGGCTCAAAGGCTGCTGCAGG - Intergenic
1147412428 17:40263338-40263360 TGAGAATCTAATGCTGCTGCTGG + Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1150739208 17:67765977-67765999 GGAGGCAGTAAGGATGCTGTGGG - Intergenic
1152081194 17:78188254-78188276 TGTGGCTGTAAGGATCCTACAGG + Intronic
1153610219 18:6877346-6877368 TGAGGCTCTAACCACGGTGCAGG + Intronic
1154512671 18:15125010-15125032 TGTGGCTCTCAGGAAGCTTCAGG + Intergenic
1156519773 18:37712448-37712470 TGAGTATCTAAGGAGGCTTCTGG - Intergenic
1157927390 18:51781150-51781172 TAGGGCTCTAAGGAAGCTGGTGG + Intergenic
1158998228 18:62945598-62945620 TGAGGCTCAAAGGCTGACGCTGG + Intronic
1159872972 18:73779225-73779247 TGAGTCTCAAAGGATGCTCATGG + Intergenic
1161405344 19:4088381-4088403 TGGGGCTCCAATGAAGCTGCAGG + Intergenic
1161988842 19:7672569-7672591 TGAGAATCTAATGCTGCTGCTGG + Intergenic
1162935506 19:13979707-13979729 TGAGGCTCCCAGGAAGCAGCAGG + Intronic
1163365304 19:16872814-16872836 TGACGCTCCCAGGATGCGGCTGG - Intronic
1165166504 19:33860846-33860868 AGACGCTGGAAGGATGCTGCCGG + Intergenic
1166059139 19:40314094-40314116 TCAGGCTCTAGAGATGCTGCAGG - Intergenic
1166624288 19:44335829-44335851 TGTGTAGCTAAGGATGCTGCTGG - Intronic
1168133491 19:54336163-54336185 TGGGGCTCTGAGGATGGAGCAGG - Intronic
925032525 2:661731-661753 TGAGCCTCACAAGATGCTGCAGG - Intergenic
925764090 2:7214285-7214307 TGAGGCTCTGGGGCTTCTGCAGG - Intergenic
927705707 2:25295186-25295208 GCAGCCTCTAAGGATGTTGCAGG - Intronic
929119422 2:38472056-38472078 TCAGGCACTAAGGATGCAGCAGG + Intergenic
929790331 2:45017800-45017822 TGTGGGGCTGAGGATGCTGCGGG - Intergenic
929895881 2:45960557-45960579 TGAGAATCTAATGCTGCTGCTGG + Intronic
930411792 2:51033157-51033179 TGAGGCTCTAACCATGCAACTGG + Intergenic
932419721 2:71594434-71594456 AGAGGCTCTGAGGCGGCTGCAGG + Intronic
933935231 2:87198557-87198579 CATGGCTCTAAGGAGGCTGCAGG - Intergenic
936357918 2:111767342-111767364 CACGGCTCTAAGGAGGCTGCAGG + Intronic
938512914 2:131969645-131969667 TGTGGCTCTCAGGAAGCTTCAGG + Intergenic
941737413 2:168994214-168994236 TGAGGCTGAAAGGATTCAGCAGG - Intronic
941860557 2:170274527-170274549 GTAGGCACTAAAGATGCTGCAGG + Intronic
1174513695 20:51075206-51075228 GGAGGCTTGAAGGATGGTGCTGG - Intergenic
1175165154 20:57038340-57038362 CCAAGCTCTCAGGATGCTGCAGG + Intergenic
1175758744 20:61546987-61547009 GGTGCCTCTTAGGATGCTGCTGG + Intronic
1175917278 20:62432438-62432460 TAAGGCTCTGAGGAGGCTGATGG - Intergenic
1176780857 21:13193189-13193211 TGTGGCTCTCAGGAAGCTTCAGG - Intergenic
1178742202 21:35212276-35212298 TGAGACCCAAAGGATCCTGCTGG + Intronic
1179607678 21:42527743-42527765 GGAGGCTCTGAGGGTGATGCTGG - Intronic
1180005914 21:45020468-45020490 TCAGGCTCTGTGGAGGCTGCGGG - Intergenic
1181118066 22:20646421-20646443 TCATGCTCAAAGGATGCTACAGG + Intergenic
1181735212 22:24876241-24876263 TCATGCTCACAGGATGCTGCAGG - Intronic
1183578619 22:38708669-38708691 TGAGGCTCAAAGGCTACTTCAGG + Intronic
1184189402 22:42884944-42884966 TGAGGCTCCAAGAGAGCTGCAGG - Intronic
1184248102 22:43245758-43245780 GGAGGCCCTAAGGATGGTGCAGG - Intronic
1185155123 22:49188878-49188900 CGAGGTTCTAAGGATGCTGACGG + Intergenic
949943278 3:9171125-9171147 TGGGGCTCTGTGGAGGCTGCTGG - Intronic
954752013 3:52819134-52819156 TGAGACGCTAAGGATGGGGCAGG + Exonic
955038448 3:55291832-55291854 TGGGGATCTTATGATGCTGCAGG + Intergenic
957991811 3:87635750-87635772 TGATTCTCCAAGGAGGCTGCAGG + Intergenic
965363850 3:167774633-167774655 TGAGAATCTAATGCTGCTGCTGG - Intronic
965387527 3:168062839-168062861 AGTAGCTCTAAGGATGGTGCCGG + Intronic
968652213 4:1764788-1764810 GGAGGCTCTAAGGAGGCTGGGGG - Intergenic
974683916 4:65199498-65199520 GGAGCTTCTAAGGATGATGCAGG + Intergenic
975311694 4:72910890-72910912 TGAGCCACTAAAGATGTTGCTGG - Intergenic
975669421 4:76765982-76766004 TGAGGCTCAAATGAGGCTGGCGG - Intronic
976667929 4:87620207-87620229 AGAGGCTATCAGGATGGTGCTGG + Intergenic
979330796 4:119419845-119419867 TGAGAATCTAATGCTGCTGCTGG + Intergenic
979680399 4:123453551-123453573 TCAGGCTCTGAGGGTCCTGCTGG + Intergenic
986494757 5:8331384-8331406 TGAGGCCGTGAGGATGCTGGAGG + Intergenic
986981322 5:13450856-13450878 TGAGGGTCTTAGGATTCTTCTGG - Intergenic
987856330 5:23424462-23424484 TCAGGCTCTAAGGATGCCTCAGG - Intergenic
988873198 5:35413407-35413429 TGAGGCACTAAGGTTGCAGATGG - Intergenic
989684438 5:44068756-44068778 TGTGGTTCTAAAGCTGCTGCTGG - Intergenic
994985187 5:106924113-106924135 TGAGAATCTAATGCTGCTGCTGG - Intergenic
998642922 5:144032397-144032419 TGGGGCTCCATGGGTGCTGCCGG + Intergenic
998940419 5:147275961-147275983 TGAATCTCCAAGGATGCAGCAGG - Intronic
1000291959 5:159878982-159879004 TGAGGATGTAAGGAGGCAGCTGG - Intergenic
1001399170 5:171436639-171436661 TGATGCTTTTAGGAAGCTGCTGG + Intronic
1002330260 5:178436082-178436104 TGAGGCACGAAGGATGCGCCTGG + Intronic
1003468229 6:6402039-6402061 TTAGGATCTATGGTTGCTGCTGG + Intergenic
1004584347 6:16985159-16985181 TAACTCTCTAAGGATGCTGCTGG - Intergenic
1006031313 6:31178596-31178618 TGAGGCACTCAGGATGCAGGAGG - Intronic
1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG + Intronic
1006428725 6:33982349-33982371 TGAGGCTCTGAGGCTGGTGGTGG - Intergenic
1007229200 6:40336698-40336720 TGGGGGTGTAAGGATGCTCCTGG - Intergenic
1007260982 6:40562913-40562935 TGTGGCTCTCAAGAGGCTGCAGG + Intronic
1008031928 6:46706543-46706565 TGAGACTCTGAAGAGGCTGCTGG + Intronic
1008731795 6:54491694-54491716 TTAGGCTCTAAATATTCTGCAGG - Intergenic
1010043657 6:71417033-71417055 TGAGGCTTGAAGGATGTTGAAGG + Intergenic
1012181276 6:96156073-96156095 TGATGTTCAAAGGATGCTTCTGG + Intronic
1014198392 6:118583513-118583535 TGGGGCTGTAAAGATGCTGCAGG - Intronic
1016769512 6:147833216-147833238 TGAGGCTCTAAATTAGCTGCAGG - Intergenic
1018252759 6:161888684-161888706 TGATGATCAAAGGATGCTGGAGG - Intronic
1018392344 6:163350126-163350148 TGGGGATCTAGGGCTGCTGCAGG - Intergenic
1018769733 6:166959901-166959923 TGAGGTTTAAAAGATGCTGCTGG + Intergenic
1019261985 7:86893-86915 TGTGGCTCTGAGGGTCCTGCAGG - Intergenic
1020963759 7:14839886-14839908 TGAGGGTATGAGAATGCTGCTGG - Intronic
1024853946 7:53754843-53754865 TTAGGCTTTAAGGGTGCTACTGG + Intergenic
1026151258 7:67789864-67789886 GGAGGCTTTAAGGAGGCGGCTGG + Intergenic
1027257110 7:76438074-76438096 TGTGGCTCTGAGGCTTCTGCTGG + Intronic
1029242529 7:99174165-99174187 TGAGAATCTAATGCTGCTGCTGG - Intronic
1031012088 7:116535031-116535053 TGAGGCTCTAAGCTTGCAGTTGG - Intronic
1031983037 7:128141937-128141959 AGAGGCTGTGAGGATGCCGCTGG - Intergenic
1033578998 7:142714505-142714527 TAAGGCTCTGAGGTTACTGCAGG + Intergenic
1035927584 8:3744999-3745021 GGAGGCTCTTAGGATTCTCCGGG + Intronic
1037832633 8:22198462-22198484 TGAGGCTGTAAGGTAGCTGGTGG + Intronic
1038287866 8:26222091-26222113 TGAGGGTCTAAGGAGCCTCCAGG + Intergenic
1039988619 8:42468720-42468742 TCAGGCTCCAGGGAGGCTGCCGG + Intronic
1041110200 8:54476464-54476486 AGAGGGTCTGAGGATGCTCCCGG - Intergenic
1041212999 8:55571606-55571628 TGAGAATCTAATGCTGCTGCTGG - Intergenic
1042819277 8:72912432-72912454 TGAGGCACTAAGGTTACTGTAGG - Intronic
1043846700 8:85171794-85171816 TGAGGGTCTCAGGAGGCTGCTGG + Intergenic
1048357304 8:133664093-133664115 TGAAACACTCAGGATGCTGCTGG + Intergenic
1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG + Intergenic
1049118979 8:140717042-140717064 GTAAGGTCTAAGGATGCTGCCGG + Intronic
1049466946 8:142755805-142755827 TGAGGCTCTGACGAAGCTGGTGG - Intergenic
1057606239 9:96499492-96499514 TCAGGCTCTTGGGATCCTGCAGG - Intronic
1059116404 9:111603685-111603707 TGAGGCTCCAAGGAAGATGATGG - Intergenic
1060479133 9:124007843-124007865 TGAAGCTCTGAGGATGGTGCTGG - Intronic
1185681557 X:1892728-1892750 GGAGGCTCTTAGCAAGCTGCTGG - Intergenic
1186275885 X:7938251-7938273 TGAGCCTCTCAAGATCCTGCTGG - Intergenic
1186503449 X:10071015-10071037 TGAGTTGCTAAGGATCCTGCAGG + Intronic
1192528545 X:71868007-71868029 TGGGGCTCTCAGAATGCTGGAGG - Intergenic
1193054101 X:77131640-77131662 TGAGGCTATGTGGATGCAGCTGG + Intergenic
1196044622 X:111244721-111244743 TTCGGCTCTAAGGAAGATGCTGG + Intergenic
1199621351 X:149704567-149704589 TGAGGTTCTAAGCCTGCTTCAGG - Intronic