ID: 1122273916

View in Genome Browser
Species Human (GRCh38)
Location 14:100581451-100581473
Sequence CTGGAGGGGCTTCCGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122273903_1122273916 17 Left 1122273903 14:100581411-100581433 CCTGGACCTGCTCACCTACCAGC 0: 1
1: 0
2: 5
3: 29
4: 308
Right 1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG 0: 1
1: 0
2: 2
3: 32
4: 198
1122273906_1122273916 3 Left 1122273906 14:100581425-100581447 CCTACCAGCAGCCTGGACAACCT 0: 1
1: 0
2: 3
3: 31
4: 257
Right 1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG 0: 1
1: 0
2: 2
3: 32
4: 198
1122273904_1122273916 11 Left 1122273904 14:100581417-100581439 CCTGCTCACCTACCAGCAGCCTG 0: 1
1: 0
2: 6
3: 25
4: 347
Right 1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG 0: 1
1: 0
2: 2
3: 32
4: 198
1122273910_1122273916 -8 Left 1122273910 14:100581436-100581458 CCTGGACAACCTCTCCTGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 132
Right 1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG 0: 1
1: 0
2: 2
3: 32
4: 198
1122273907_1122273916 -1 Left 1122273907 14:100581429-100581451 CCAGCAGCCTGGACAACCTCTCC 0: 1
1: 1
2: 3
3: 43
4: 320
Right 1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG 0: 1
1: 0
2: 2
3: 32
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122273916 Original CRISPR CTGGAGGGGCTTCCGGCTCC TGG Intronic
900137648 1:1125179-1125201 CTGGAGGAGCTCCCGGCTCCCGG + Intergenic
900801090 1:4737487-4737509 CTCGGGGGGCTTCCGTCTCGGGG - Intronic
901409353 1:9071830-9071852 CTGGCGGGCCTGCGGGCTCCGGG + Intronic
902262343 1:15236124-15236146 GTGGAGAGGCTGCCGCCTCCAGG - Intergenic
902410493 1:16208870-16208892 CCAGAGGAGCTTCGGGCTCCTGG - Exonic
903131730 1:21284004-21284026 CTGGAGAGGCCTCCTGATCCTGG - Intronic
903211540 1:21821961-21821983 CTAGAGGGGCTTCGGGCACATGG + Intronic
903216682 1:21847353-21847375 CCGGAGGGGCTGCCGGCGCTAGG + Exonic
903383950 1:22914827-22914849 GTGGAGGAGCTTCCCACTCCAGG + Intronic
904839666 1:33364167-33364189 CTGGAGGGTCTGCCTGCTCTGGG + Intronic
904918449 1:33986963-33986985 CTGCAGGGTCTGCTGGCTCCAGG + Intronic
905202337 1:36323231-36323253 CTGGAGGGGCGTCCGCGCCCGGG - Intronic
906124741 1:43420831-43420853 CTCGAGGGCCCTCAGGCTCCAGG - Exonic
907136168 1:52141875-52141897 ACTGAGGGGCTTCCGGTTCCCGG + Intergenic
910257174 1:85259678-85259700 CTGGGGTGGCTTCCGGTTTCCGG - Intergenic
912685135 1:111756144-111756166 CTGGAGGGGCTGCGGGCGGCCGG + Exonic
1065801500 10:29356910-29356932 CTGAAGGGCATTCCAGCTCCAGG - Intergenic
1066446697 10:35490635-35490657 CTGGAAAGACTTCCGGCTCTGGG - Intronic
1067275289 10:44828413-44828435 CTGGTGGAGCTTCAGGATCCTGG - Intergenic
1067295467 10:44973028-44973050 CTTCAGGAGCTTCTGGCTCCTGG + Intronic
1067295682 10:44974106-44974128 CTGGAGGGGCTTGGTGCCCCAGG - Intronic
1067576210 10:47410095-47410117 CTGGAGGGCCTCACTGCTCCAGG - Intergenic
1067769867 10:49115430-49115452 CTGGCGCGGGCTCCGGCTCCGGG - Exonic
1069793009 10:71035327-71035349 CTATAGGGGCTGCCGTCTCCTGG + Intergenic
1071545290 10:86524319-86524341 CTGGAGGGAGTTCAGACTCCTGG + Intergenic
1072626233 10:97114004-97114026 CTGGAGTGGCTTCAGGCACCTGG - Intronic
1073291753 10:102416677-102416699 CTGAATGGGCTACCTGCTCCAGG - Exonic
1075713264 10:124542033-124542055 CTGCAGGGGCTTCCAACTCCAGG - Intronic
1075730041 10:124630609-124630631 CTGGAGTACCTTCCCGCTCCTGG - Intronic
1075795339 10:125116124-125116146 CAGGAGGGGCCACCGACTCCAGG + Intronic
1076001818 10:126918576-126918598 CTGGAGGGGGATCCTGCTACCGG - Intronic
1076683575 10:132187053-132187075 CTGGAAGGACATCCTGCTCCTGG - Exonic
1076871883 10:133198536-133198558 CAGGAGGGGCTGCCTGCGCCCGG - Intronic
1077027243 11:446370-446392 CTGCAGGGGCTTCAGGCTGGGGG - Intergenic
1077216934 11:1398869-1398891 CTGGGGGGGCTCCAGGCTCCAGG - Intronic
1077432075 11:2520649-2520671 CTGATGTGGCTGCCGGCTCCAGG - Intronic
1081958038 11:47110797-47110819 CTGAAGGGGCTTCAGGGCCCTGG - Intronic
1082787556 11:57325036-57325058 CTGCACGGGCTTCCCACTCCCGG - Intergenic
1084008763 11:66336347-66336369 CTGGACGGGCTGGGGGCTCCAGG + Exonic
1087095393 11:94313109-94313131 CTGGAGGGTGTTCCTTCTCCTGG + Intergenic
1087182940 11:95157378-95157400 CGGGCTGGGCTGCCGGCTCCGGG + Intergenic
1088597547 11:111451280-111451302 CTGGCGGCGCTTCCGGGCCCTGG + Intronic
1088991749 11:114960070-114960092 CTGGAGGTGCTGCAGTCTCCTGG + Intergenic
1089243105 11:117098368-117098390 CTGGCGGGGCTGCCGGGGCCGGG - Exonic
1089572616 11:119420413-119420435 CTGGAGGGGCCTGCGGCACAGGG + Intronic
1091284452 11:134400262-134400284 CCGGAGGAGCTTCTGGCTCGGGG - Intronic
1091447570 12:552794-552816 CTGGAGGGGCTTGCTGTCCCTGG + Intronic
1093685206 12:22046626-22046648 CTGGAGGGGCTGGGGCCTCCGGG + Intronic
1096590445 12:52655462-52655484 CTGCATGGGCTGCTGGCTCCGGG + Intergenic
1097246799 12:57611547-57611569 CTGGAGCGGCTGCCGCATCCCGG + Intronic
1097264327 12:57737158-57737180 CAGGAGGGCCTCCTGGCTCCGGG - Exonic
1101788909 12:107910938-107910960 CTGCAGGGCCTTCCTCCTCCAGG - Intergenic
1101828684 12:108240573-108240595 GGGGAGGGGCTTCGGGCTGCAGG + Intronic
1103504225 12:121430505-121430527 GCGGGGGGGCTTCTGGCTCCTGG - Intronic
1104458097 12:128932118-128932140 ATGAAGGTGCTGCCGGCTCCTGG + Intronic
1108592864 13:51926265-51926287 CGGGAGGGGCTCCCATCTCCAGG - Intergenic
1110480287 13:75965943-75965965 CTGGAGGGGCTTACATCTCAGGG + Intergenic
1112356573 13:98678778-98678800 CTGGAGGGGCAGCCGGCTTAGGG - Intergenic
1113398950 13:109974016-109974038 TTGGAGGGGCGTCCGGAGCCTGG + Intergenic
1113612522 13:111657259-111657281 CTGGAGAGTCTCCTGGCTCCTGG + Intronic
1114549507 14:23524923-23524945 CTGGGGGAGCCTCCGGCTGCAGG - Exonic
1117814582 14:59583724-59583746 ATGGAAGGACTTCCGACTCCAGG + Intergenic
1119522827 14:75298769-75298791 CCGGAGAGGCCTCCAGCTCCTGG - Intergenic
1120874500 14:89363172-89363194 CTGGAGGGGCTTCCTGAGCAGGG - Intronic
1121633385 14:95437577-95437599 CAGGAGAGGCTTCCCGGTCCTGG + Intronic
1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG + Intronic
1122346476 14:101064203-101064225 CTGGAGAGGGCTCCGGCTGCAGG - Intergenic
1122940496 14:104978900-104978922 CTGGGCGGGGTTCTGGCTCCAGG - Intergenic
1124831660 15:33154704-33154726 CTGGATGTTCGTCCGGCTCCTGG + Exonic
1125516366 15:40323524-40323546 CCGGCGGGGCTCGCGGCTCCCGG + Intergenic
1129112609 15:73346546-73346568 CTGGAGGGACCTCCTGCTACTGG - Intronic
1131509233 15:93040309-93040331 CTGCAGGGCTCTCCGGCTCCGGG - Intronic
1131742967 15:95414326-95414348 CTGGAGGGGCTTCAGTCACATGG - Intergenic
1132601330 16:774463-774485 CTGGAGGGGCTACAGGCCCTGGG - Exonic
1132700212 16:1219048-1219070 GTGGAGGGGCTCGCCGCTCCTGG - Exonic
1132717151 16:1296914-1296936 CAGGAGGGGCTGCCGGCGTCAGG - Intergenic
1132751209 16:1458550-1458572 CTGGGGGTGCTTCCGGGGCCTGG - Intronic
1132853046 16:2033384-2033406 GTGGAGGGGCTCCCGGAGCCCGG - Intronic
1135419735 16:22297683-22297705 GAGGAGGGGCAGCCGGCTCCAGG + Intronic
1136477319 16:30521607-30521629 ATGGAGGGGCTTCAGGCAGCCGG - Exonic
1136627903 16:31472889-31472911 AGAGAGGGGCTTCCGGCCCCTGG + Intronic
1138023110 16:53502762-53502784 CTGGAGGGGCCCGCGGCTCCCGG - Intronic
1138174105 16:54880564-54880586 ATGGGGGGGCTTCCCACTCCTGG - Intergenic
1139364715 16:66426600-66426622 CTGGCAGGGCTTCCCGCTCGCGG - Intergenic
1141008057 16:80371644-80371666 CTGGAGGTGCTCCCAGCACCAGG + Intergenic
1141688833 16:85585288-85585310 CTGGATGGGCCTCTGGTTCCTGG - Intergenic
1141935193 16:87233805-87233827 CTGGAGGTGCTGTGGGCTCCAGG + Intronic
1142866463 17:2794483-2794505 CTGGGGTGGCTTCAGGCTGCTGG - Intronic
1143001017 17:3795067-3795089 CTGGATTGGCTCCTGGCTCCTGG - Intronic
1143276017 17:5711425-5711447 TTGGAGCGGCTGCTGGCTCCTGG + Intergenic
1143451273 17:7038309-7038331 CTGGAGGGGGTCCCTGCTGCTGG + Exonic
1143497837 17:7322614-7322636 CTGGGGTAGCTGCCGGCTCCAGG - Intronic
1145282144 17:21475998-21476020 CTAGAGAGGCTTCCAGGTCCTGG + Intergenic
1145395296 17:22489612-22489634 CTAGAGAGGCTTCCAGGTCCTGG - Intergenic
1146637965 17:34519980-34520002 CTGTTGGGGCTTCATGCTCCAGG - Intergenic
1146816189 17:35944140-35944162 CTGGACGGGATTCCAGCCCCAGG + Intergenic
1147819161 17:43231511-43231533 CTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1147819747 17:43234542-43234564 CTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1147821059 17:43241940-43241962 CTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1147821865 17:43246429-43246451 CTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1147825467 17:43267388-43267410 CTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1147826598 17:43273855-43273877 CTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1147827487 17:43278733-43278755 CTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1147828595 17:43284894-43284916 CTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1147829702 17:43291045-43291067 CTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1147830783 17:43297168-43297190 GTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1147831481 17:43300796-43300818 CTGGAGGGGCTTCCGGGAGCAGG + Intergenic
1148687838 17:49510479-49510501 CTGGAGGTGCCTCAGGCTCCTGG - Exonic
1148911163 17:50943858-50943880 CTCGAGGGGCTTCTGGGTGCCGG + Intergenic
1151605138 17:75131130-75131152 CTGGGCGGGCTCCTGGCTCCCGG - Intronic
1151919362 17:77141498-77141520 CTCGAGGGGCGGCCGGCGCCCGG - Intronic
1151966483 17:77434229-77434251 CTGGCTGGGGTTCTGGCTCCAGG + Intronic
1152751019 17:82062440-82062462 CTGGATGGGCTGCTGTCTCCGGG - Intronic
1153006136 18:500333-500355 CTGGGGGCGCACCCGGCTCCCGG - Intronic
1154166357 18:12017511-12017533 CTGGGGGGACTTCCTGTTCCTGG + Intronic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1160890590 19:1376606-1376628 CTGGAGGCGCTTCCACCGCCAGG - Exonic
1160911458 19:1475766-1475788 CAGGAGGGGCTTCCAGCTCTAGG + Intronic
1160975252 19:1789818-1789840 CTGGAGGGGCGGCGGGCTCGGGG - Intronic
1161241915 19:3227577-3227599 CTGGAGGTGCACCCGGCTCCTGG + Intronic
1161916323 19:7231064-7231086 CTGGTGTGGCTCCTGGCTCCTGG - Intronic
1162770893 19:12948816-12948838 GAGGTGGGGCTTCCGCCTCCCGG + Intronic
1163213344 19:15858025-15858047 CTGGAAGGCCTTCCAGCTCTTGG + Intergenic
1163371250 19:16902553-16902575 CAGGAGGAGCTTCCGGCTCCAGG - Intronic
1163666320 19:18605751-18605773 CTGGAGGGACTTCTGGCCTCAGG - Intronic
1163786259 19:19276478-19276500 CAGGAGGGGCTTCCTGCAACAGG + Intronic
1164808933 19:31140846-31140868 CTGGAGGGGCTGGCGTCTCAAGG + Intergenic
1165076511 19:33282554-33282576 CTGGTGGGGCTGCCTGCTGCTGG + Intergenic
1166253708 19:41587674-41587696 CTGGAGGGGCCTGTGGGTCCAGG - Intronic
1167139935 19:47643436-47643458 CTGGAGGGGCATCTGTCACCTGG + Intronic
1167710662 19:51108487-51108509 CTGGATGCGCCTACGGCTCCGGG + Intergenic
924987985 2:288453-288475 GTGGAGGGGCTTCCAGCACGTGG - Intronic
925193317 2:1902916-1902938 CCTGAGGGGCTTTCAGCTCCTGG + Intronic
925422954 2:3726529-3726551 GCGGAGGGGCTCCCGCCTCCTGG + Intronic
926292198 2:11540010-11540032 GTGCAGGGGCTCCCGCCTCCTGG - Intronic
927911082 2:26900171-26900193 CTGGAGGAGCTTCTGGGTGCTGG - Intronic
929523749 2:42680244-42680266 CTGGAGGTGCTTAGGGCTCTGGG - Intronic
932418316 2:71586804-71586826 AGGGAGGCGCCTCCGGCTCCAGG - Intronic
932735844 2:74254054-74254076 CTGGCGGTGCTTGCGGCTGCAGG - Intronic
932765193 2:74464900-74464922 GAGGAGGGGCTTCGGGCTGCGGG + Exonic
935112556 2:100105737-100105759 TTGGAGGGGCTTCCGGTTCTAGG - Intronic
936856100 2:116958922-116958944 CTGGAGGGAATTCCAGGTCCAGG + Intergenic
937340782 2:121089138-121089160 CTGCCCGGGCTTCAGGCTCCAGG - Intergenic
937462447 2:122101221-122101243 CTGCAGGGCCTTCCATCTCCTGG - Intergenic
940649442 2:156426748-156426770 CTGGAGAGGCTGCCAGCTCTAGG + Intergenic
942027208 2:171922336-171922358 CTTGAGGCGCTTCCGCCGCCGGG + Intronic
944264181 2:197706052-197706074 CTGGAGTGGCTTCCGGAACTGGG - Exonic
946220036 2:218217819-218217841 CCGGAGCGAGTTCCGGCTCCAGG - Intronic
947952742 2:234161982-234162004 TTGGAGAGGCTTCAGGCTCTGGG - Intergenic
948747418 2:240106741-240106763 CTGGAGGGGCTTCCTTGTCCTGG + Intergenic
1169340208 20:4790586-4790608 CTGCAGGGGCTTCAGGCCCCTGG + Exonic
1173269023 20:41514761-41514783 CTGGTGGAGATTACGGCTCCTGG - Intronic
1173793154 20:45841070-45841092 CTCCAGGGTCTTCCAGCTCCTGG - Exonic
1174173733 20:48632358-48632380 GTGGAGGGGCTGCCTTCTCCAGG - Exonic
1175770200 20:61618595-61618617 CTGGAGGTGCATCCAGCACCCGG + Intronic
1175809308 20:61849219-61849241 AGGGAGGGGCTTCCTTCTCCAGG - Intronic
1176515069 21:7777740-7777762 CTGAAGCAGCTTCCAGCTCCGGG - Intergenic
1178649097 21:34407752-34407774 CTGAAGCAGCTTCCAGCTCCGGG - Intronic
1180061589 21:45388130-45388152 CGGGAGTGGCTTCCAGCTCCTGG - Intergenic
1182122718 22:27797860-27797882 CCGGACGGGCCTCCGGGTCCTGG + Exonic
1183425862 22:37739129-37739151 CTGGAGGGTCTCCAGGGTCCTGG + Intronic
1184749902 22:46479335-46479357 CAGGAGGGCCTTCGGGCTCGGGG - Intronic
1184798701 22:46747383-46747405 CTGGAGGGACTTCTGTCCCCAGG + Intergenic
1185074453 22:48675844-48675866 CTGCAGGGCCTTCAGGCTTCAGG - Intronic
1185183066 22:49374094-49374116 GTGGAGGGGCTTCGGGCACCTGG - Intergenic
1185307372 22:50127516-50127538 CTGGGATGGCTTCCAGCTCCGGG - Intronic
949167362 3:958789-958811 CTCCAAGTGCTTCCGGCTCCAGG + Intergenic
950866995 3:16197242-16197264 CTGGTGGGGCTGCCAGCTCTGGG - Intronic
952825033 3:37517623-37517645 CTGGAGGGGCTCCGTGCACCAGG - Intronic
953449218 3:42992151-42992173 CTGGAGAGGCTCCTGGCTCCTGG + Intronic
954429922 3:50465094-50465116 CTGGAGTGGCCTCCTCCTCCGGG - Intronic
956873539 3:73440972-73440994 CTGGAAGGGCTTTCCGCCCCTGG - Intronic
962422886 3:135243615-135243637 CAGGAGGGGCTCCCAGCTGCCGG + Intronic
967854282 3:194104687-194104709 CTCCAGGGGCTTCTGTCTCCAGG + Intergenic
968606817 4:1539410-1539432 CTGGGGGGGCTCCAGGCCCCTGG - Intergenic
968616270 4:1579132-1579154 CTGGAGGCGCAGCCGCCTCCGGG - Intergenic
968800828 4:2742382-2742404 CTGCAGGGGGTTCTGGCTGCTGG + Exonic
968844157 4:3030622-3030644 CTGGAGGGGCGGCAGGCTCTAGG + Intronic
969314159 4:6371477-6371499 CTGGATGGCCTCCCGACTCCAGG - Intronic
969728595 4:8940110-8940132 GGGGAGGGGATTCCAGCTCCAGG - Intergenic
969864877 4:10068661-10068683 CTTGAGGGACCTCCTGCTCCAGG + Intergenic
977639869 4:99345012-99345034 GTGGATGGGCTTCCCGCTGCAGG + Exonic
981044437 4:140252757-140252779 CTGGTGGGGCCTCCCGCTCTCGG + Intergenic
985713227 5:1441987-1442009 CTGGAGGGGCTCCCAGCACCTGG - Intronic
996597827 5:125225907-125225929 CTGGAAGGGCTTCCTGCACAGGG + Intergenic
997633706 5:135389245-135389267 CTGCAGGGCCCTCCGGGTCCAGG + Intronic
1001512237 5:172332114-172332136 CTGGAGGGGCATCCGCCTCATGG - Intronic
1001561941 5:172675455-172675477 CAGGAGGGGCTTGCGGGTCCTGG + Intronic
1002044644 5:176535068-176535090 CTGGAGGCCCTTCTGTCTCCTGG - Intronic
1002701802 5:181129998-181130020 TTGGAGGGGCATCCGTCTTCTGG - Intergenic
1004329778 6:14710793-14710815 CTGGTGTGGCTTCTGTCTCCTGG - Intergenic
1004731806 6:18366406-18366428 CAGGAGGGGCCACCTGCTCCTGG + Intergenic
1005012636 6:21350302-21350324 CTTGAGGGCCTTCTGGCTCCTGG + Intergenic
1006786973 6:36674766-36674788 CTGGATGGTCTTCCTGTTCCTGG - Intergenic
1007760110 6:44128274-44128296 CTGGAGAGGCGGCCGGCCCCGGG + Intronic
1012912770 6:105136742-105136764 CTCGAGGGGCTCCCGGCCCTTGG - Intronic
1015038927 6:128692808-128692830 CTGGAGGTGCCTCAGCCTCCTGG + Intergenic
1015244759 6:131063296-131063318 CGGGAGGGGCTTCCGCCGCGAGG - Exonic
1019479427 7:1259795-1259817 CTCCAGGGGCTTCTGGCTCGTGG + Intergenic
1024004637 7:45216510-45216532 CTGGAGAAGCTGGCGGCTCCTGG + Intergenic
1026822164 7:73557223-73557245 TGGGAGGGGATTCCGGCTTCCGG - Intronic
1029593961 7:101526795-101526817 CTCCAGTGGCTTCAGGCTCCAGG - Intronic
1033097315 7:138442532-138442554 CAGGAGGGGCTACCTGCCCCTGG - Intergenic
1033264586 7:139873833-139873855 ATGCAGGGTGTTCCGGCTCCTGG - Intronic
1035384390 7:158460550-158460572 CAGGAGGGTCATCCAGCTCCAGG + Intronic
1035672827 8:1433146-1433168 CTGGAGGGGCTTTGGGCTCATGG - Intergenic
1036647021 8:10617243-10617265 CTGCAGGGGCTTCTCGGTCCAGG - Intronic
1036651925 8:10649761-10649783 CTGGCTGTGCTTCCGGCTCCAGG + Intronic
1036793621 8:11740113-11740135 CTCCTGGGGCTTCCGGCTTCAGG - Intronic
1037674363 8:21041279-21041301 CTGGCTGGGCTGCCGGCTGCGGG - Intergenic
1038046316 8:23768336-23768358 CTGGAGGCCCTTCCGTCTTCTGG - Intergenic
1044412638 8:91901729-91901751 CTGGAGAGGCTACCCTCTCCAGG - Intergenic
1044939376 8:97325027-97325049 CTGAATGGGCTTTGGGCTCCTGG + Intergenic
1047181043 8:122588420-122588442 CTGGGGGGGCCTCAGGCTTCAGG - Intergenic
1047275571 8:123402409-123402431 CAGGAGGGGCTGCCTGCCCCTGG - Intronic
1047959932 8:130003878-130003900 CTGAAAGGGCTTCGGCCTCCTGG - Intronic
1048876061 8:138837734-138837756 CTGGAGGGCCCTGCGGTTCCAGG + Intronic
1049595984 8:143483584-143483606 CTAGGCGGGCTCCCGGCTCCTGG + Intronic
1049804082 8:144531031-144531053 CCAGAGGGCCTTTCGGCTCCTGG + Intronic
1052941125 9:34132853-34132875 CAGGAGGGGCTGCCTGCCCCTGG + Intergenic
1056807539 9:89740669-89740691 CTGGAGGGGCTGCTCGTTCCAGG + Intergenic
1059346352 9:113631610-113631632 CTGGAGGGGTCTCAGGCTCCGGG + Intergenic
1061377871 9:130236749-130236771 CTGCAGTGGCTCCCGGCCCCAGG + Exonic
1061390880 9:130316454-130316476 CAGGAGGGGCTGCCGCCTGCAGG - Intronic
1062379028 9:136277871-136277893 CTGGAGGAGCTGCCGGTTCTGGG - Intergenic
1062682494 9:137789230-137789252 CAGGAGGGGCTGACGGCTTCGGG - Intronic
1187235925 X:17467051-17467073 CTGGAAGGGCTTCAGATTCCTGG + Intronic
1191715487 X:64191183-64191205 CTGGAGGGACTTCCGTCCTCTGG - Exonic
1196550196 X:117015433-117015455 CTGGAGGGACTTGGGGCTCCAGG - Intergenic
1196685354 X:118505789-118505811 CTGGAGAGCCTTCCGGCCCAAGG - Intronic
1197900676 X:131368239-131368261 GTGAAGGGGATTCCTGCTCCAGG - Intronic
1198099391 X:133411650-133411672 CAGGAGGGGCTTCTGCCACCAGG - Intronic
1199615118 X:149649952-149649974 CTGGAGGGGCTGCCTGCTGCTGG - Intergenic