ID: 1122274778

View in Genome Browser
Species Human (GRCh38)
Location 14:100585989-100586011
Sequence AAGGGTTTGCAGGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122274772_1122274778 6 Left 1122274772 14:100585960-100585982 CCCTGATTATAGTGAGAGTCGGG 0: 1
1: 0
2: 1
3: 1
4: 48
Right 1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG 0: 1
1: 0
2: 4
3: 24
4: 227
1122274770_1122274778 14 Left 1122274770 14:100585952-100585974 CCAAGCTGCCCTGATTATAGTGA 0: 1
1: 0
2: 0
3: 14
4: 408
Right 1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG 0: 1
1: 0
2: 4
3: 24
4: 227
1122274774_1122274778 5 Left 1122274774 14:100585961-100585983 CCTGATTATAGTGAGAGTCGGGA 0: 1
1: 0
2: 1
3: 3
4: 28
Right 1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG 0: 1
1: 0
2: 4
3: 24
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122274778 Original CRISPR AAGGGTTTGCAGGATGCTGC TGG Intronic
900976111 1:6017453-6017475 ATGGGTTTTCAGTATGTTGCTGG + Intronic
901129951 1:6955970-6955992 AAGGACTTGCCGGAAGCTGCAGG - Intronic
901201327 1:7469038-7469060 AAGGGTTTGGAGGCTGGGGCTGG - Intronic
901674455 1:10874843-10874865 AGGGGAGTGCAGGCTGCTGCTGG + Intergenic
901941171 1:12663070-12663092 AAGGGCTTCCAGGAGGCTGCAGG + Intronic
904830532 1:33303703-33303725 GAGGGGTTCCAGGAAGCTGCAGG - Intergenic
905217158 1:36416915-36416937 CAGACTTTGCAGGATGCAGCAGG - Intronic
907480800 1:54744506-54744528 AAGGCTTTGCCGCAGGCTGCAGG + Intergenic
907526878 1:55058864-55058886 AAGGGTTTCCTAGAGGCTGCAGG + Intronic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
913379099 1:118188735-118188757 AAGGGTATGAAGAATGCTGGGGG - Intergenic
917506246 1:175629624-175629646 AAGGGGTTGCAGGAACCTGAGGG + Intronic
920213324 1:204344798-204344820 AAGGATTGGCAGGATGGGGCTGG - Intronic
920764771 1:208821667-208821689 AAGGGAAGGCAGGCTGCTGCTGG + Intergenic
920987744 1:210906337-210906359 AGGGGATGGCAAGATGCTGCTGG + Intronic
923541588 1:234891993-234892015 AAAAGTTTTCAGGATGCTGCTGG + Intergenic
1063146122 10:3296719-3296741 ACGGGTTTGAAGGATGCTGAGGG - Intergenic
1064552559 10:16519582-16519604 ATGGGTCTGCAGTATTCTGCTGG - Intronic
1066460535 10:35608541-35608563 AGGGGGCTGCAGGCTGCTGCAGG - Exonic
1067006940 10:42673137-42673159 AAGGCTTTGCAGGATTATGAGGG + Intergenic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1071416404 10:85445711-85445733 AGGTGTCTGCAAGATGCTGCAGG + Intergenic
1071991018 10:91100932-91100954 ATGGGTTAGCAGGAGGCTGAGGG + Intergenic
1072444824 10:95489858-95489880 GTGAGTTTGCAGGATGCTGGGGG - Intronic
1073124044 10:101139115-101139137 AAGTGTTTGCGGGATACTGAGGG + Intergenic
1077209187 11:1360575-1360597 AACGGTTTGCCGGATGGTCCGGG - Intergenic
1078136266 11:8654509-8654531 AAGGATGTTCAGGGTGCTGCGGG - Exonic
1078392553 11:10948754-10948776 CAGGTTTAGCAGGATGATGCTGG + Intergenic
1081576053 11:44319195-44319217 AGGAGGTTGCAGGAGGCTGCCGG - Intergenic
1081684399 11:45031866-45031888 ATGGATTTGTAGGATGATGCTGG - Intergenic
1084426521 11:69087134-69087156 AAGGGGCTGCAGGTGGCTGCGGG - Exonic
1084773285 11:71357896-71357918 AGTGGACTGCAGGATGCTGCAGG + Intergenic
1085328640 11:75628256-75628278 GAGGGACTGCAGGATGCTGGGGG + Intronic
1086210285 11:84310080-84310102 AAGGGAATCCAGGATTCTGCAGG + Intronic
1086892188 11:92271064-92271086 CAGGGCTTGGAGGCTGCTGCAGG - Intergenic
1088824753 11:113484165-113484187 GAAGGTTTGCTGGATACTGCTGG - Intergenic
1090311969 11:125748973-125748995 AAGGGTTTGTAGCAACCTGCAGG - Exonic
1091668009 12:2433105-2433127 AAGGGTGTCCAGGCTGCTGCTGG + Intronic
1091719105 12:2799666-2799688 AAGGGTATGAAGGATGCTGAGGG + Intronic
1091812860 12:3414580-3414602 AGGGGCTTGGAGGCTGCTGCGGG - Intronic
1091868853 12:3869798-3869820 ATGGGTTTGCAGTCTGGTGCAGG - Intronic
1092090967 12:5803461-5803483 AAGGGTTTCCAGAATGCTAAAGG + Intronic
1092427049 12:8383125-8383147 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1095541585 12:43314832-43314854 AAGGACTTGGAGGCTGCTGCAGG - Intergenic
1101652972 12:106694430-106694452 AGGGGCCTGAAGGATGCTGCAGG + Intronic
1102451067 12:113042528-113042550 AAGGGACTGGAGGGTGCTGCTGG + Intergenic
1106345759 13:28875974-28875996 AATGGTGTGCAGGCAGCTGCAGG - Intronic
1106793744 13:33183384-33183406 AAGGACTTGCACGTTGCTGCTGG + Intronic
1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG + Intergenic
1107645044 13:42485447-42485469 AAGGCTTTGCATGTTTCTGCAGG + Intergenic
1108437072 13:50411158-50411180 AGGGGCTTGCAGGCTGGTGCGGG + Intronic
1108818763 13:54320700-54320722 CAGGCTTTGCAGGAAGGTGCTGG - Intergenic
1112882564 13:104125064-104125086 CAGTTTTTGCAGGGTGCTGCTGG + Intergenic
1114015050 14:18420769-18420791 ACAGGATTCCAGGATGCTGCTGG - Intergenic
1115202944 14:30873768-30873790 AAACGTTAGCAGGATGGTGCGGG + Intergenic
1117341332 14:54794838-54794860 AATGGTTTGGAAGAGGCTGCAGG + Intergenic
1117783093 14:59255060-59255082 AAGTGTTTTCAGGATGCTAATGG + Intronic
1121080307 14:91102703-91102725 TGGGGATTGGAGGATGCTGCTGG + Intronic
1121515715 14:94548552-94548574 CAGGGTTTGGAGGATGAAGCAGG + Intergenic
1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG + Intronic
1202928571 14_KI270725v1_random:17660-17682 AAGAGTTTGCAGGAATCTGGAGG + Intergenic
1124957129 15:34367027-34367049 AAGGGGTTGGGGGATGCTGGGGG + Exonic
1126770631 15:52052527-52052549 AATGGTTTGCAGGATCTTTCAGG - Intronic
1127920830 15:63492835-63492857 AAGTGTTTGTAGGATGAAGCTGG + Intergenic
1128383901 15:67133614-67133636 AAGGGTTGGGAGGATGTTTCAGG + Intronic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1128720236 15:69942553-69942575 AGGGGTGTGCAGGAGGCAGCTGG + Intergenic
1129170344 15:73803761-73803783 AAGGGTTTGCAGTCTGCTGCTGG - Intergenic
1129615612 15:77097017-77097039 AAGGGGTTGCAGGAGGCCTCAGG - Intergenic
1132027274 15:98414219-98414241 AAAGTGCTGCAGGATGCTGCTGG - Intergenic
1132222641 15:100116597-100116619 ATGGGGTTGCAGGATGCACCTGG + Intronic
1132472830 16:116117-116139 TAGTGTTTCCAGGATGCTGTAGG - Intronic
1132684463 16:1156520-1156542 GAGGCTTTGCAGGAGGCGGCAGG + Intronic
1133371207 16:5247240-5247262 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1136137598 16:28266584-28266606 AAGGGCTTTCTGGATGCTACAGG + Intergenic
1136238854 16:28932210-28932232 AAGGGTTGGAAGGACTCTGCCGG + Intronic
1137061564 16:35795331-35795353 AAGGATTCGCAGGATGCCTCAGG - Intergenic
1137568750 16:49550952-49550974 CTGGGTTTGCAGGAAGCTGCTGG + Intronic
1137784963 16:51131030-51131052 AAGAGTTTGAAGGAAGCTACTGG + Intergenic
1138590814 16:57998797-57998819 AAGGGTTGGCAGGAAGCTGGAGG - Intronic
1138614983 16:58158087-58158109 AAGGGTATGCAGAATGTTGTTGG - Exonic
1138834489 16:60417247-60417269 AAGGATTTTCTGGATCCTGCTGG + Intergenic
1142359547 16:89619706-89619728 AAGGGAGTGCAGGGGGCTGCAGG - Intronic
1144955667 17:19017705-19017727 CAGGGTTTCCAGGAGGCTGTGGG - Intronic
1145365898 17:22266626-22266648 AAGGATCTGCAGGATGCCTCAGG + Intergenic
1145745890 17:27319444-27319466 AAGGGTCTGCAGGCAGCTTCTGG + Intergenic
1145812120 17:27770832-27770854 AAGGGTCTGGGGGATGCGGCAGG - Intronic
1147604902 17:41769040-41769062 GAGGTTGTGCAGGATGCTGGTGG + Exonic
1147915196 17:43881621-43881643 AAGGGTCAGCAGAAGGCTGCAGG + Intronic
1149369690 17:55980632-55980654 AAGGGTTCTCAGGAGGCTCCTGG + Intergenic
1150061732 17:62074500-62074522 AAGGTTTTGAAGAATGCTACTGG + Intergenic
1150755997 17:67914435-67914457 AAGGATTTGCAGAATCCTGCAGG + Intronic
1151458752 17:74242223-74242245 AAGGGCTTGGAGGAGGCTGGAGG + Intronic
1154379834 18:13838978-13839000 AAGGATGTGAAGGACGCTGCCGG + Intergenic
1159228147 18:65567865-65567887 AAGGGGTTGCCAGATGCTGGGGG + Intergenic
1159912740 18:74161870-74161892 AGGGGATTGCAAGATGTTGCTGG - Intergenic
1160739196 19:678080-678102 AGGGGTATGTAGGAGGCTGCAGG + Intronic
1162177558 19:8842452-8842474 GGGGGTTTGCAGGATGATGAAGG + Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162766768 19:12924557-12924579 AGGGGTTTGGAGGATAATGCTGG + Intronic
1164477250 19:28585244-28585266 AAGTGATTGCAGGGTGGTGCAGG + Intergenic
1164577595 19:29414750-29414772 AAGGATTTGCAGGAGTTTGCAGG - Intergenic
1164728559 19:30483683-30483705 AAGGGTTTGGAGCAAGCTACCGG - Intronic
1165495234 19:36148838-36148860 CAGGGTGTGCAGGACGCTGTGGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166855274 19:45780117-45780139 AAGGGTGTGCAGGATGGTTAGGG + Exonic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167524925 19:49977668-49977690 GAAGGTTTGGAGGAGGCTGCTGG + Intronic
1167591351 19:50406145-50406167 CAGGGTGTGCAGCAGGCTGCGGG - Intronic
1168011468 19:53537230-53537252 CAGGGTCTACAGGATGTTGCAGG - Intronic
1168013455 19:53553617-53553639 CAGGGTCTACAGGATGTTGCAGG - Intronic
925060645 2:887493-887515 AAGGGTCTGCAGGGTGCTCGTGG - Intergenic
927075932 2:19577620-19577642 AAAGGATGGCAGGATGATGCAGG + Intergenic
928112479 2:28521933-28521955 CAGGGAGTGCAGGCTGCTGCAGG - Intronic
929113003 2:38421009-38421031 AAGAGTCTACAGGAAGCTGCTGG - Intergenic
929117635 2:38457615-38457637 AAGGGGCTCCAGGAAGCTGCAGG - Intergenic
929581902 2:43086673-43086695 AATGCTTTGCAGGAAGCAGCAGG - Intergenic
929811369 2:45191718-45191740 AAGGGTAGGGAGGCTGCTGCAGG + Intergenic
930570260 2:53077452-53077474 AAGGGGTTGATGGAAGCTGCTGG - Intergenic
933987510 2:87604194-87604216 AAGTGTTTGCAGGCAGCCGCTGG - Intergenic
935495272 2:103772953-103772975 AAGGGATTGAAAGTTGCTGCCGG - Intergenic
936306329 2:111346614-111346636 AAGTGTTTGCAGGCAGCCGCTGG + Intergenic
936340214 2:111624462-111624484 ATGGGATTGCTGGATGTTGCTGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940129779 2:150368426-150368448 ATGGGATTCCATGATGCTGCAGG - Intergenic
940988481 2:160073968-160073990 AAGGCTTAGGAGGCTGCTGCAGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942311230 2:174658776-174658798 AAGGCTTTGCTGGATGCTGTGGG - Intronic
942548638 2:177091548-177091570 GAGGGATTGTAGGATGCTGCAGG - Intergenic
942831133 2:180238360-180238382 AAGGGTTAGCAGGCTGGTCCAGG - Intergenic
944125527 2:196288773-196288795 AGGGCTTGGCAGGATGCTGTGGG - Intronic
944370784 2:198981025-198981047 AAGGGGTTCGAGGATGCTACTGG + Intergenic
945706690 2:213243529-213243551 AAGTGCTTACAGGAAGCTGCAGG + Intergenic
947740198 2:232481433-232481455 AAGGGTGTGCGTGATGCTCCCGG + Intronic
948584821 2:239012665-239012687 AAGGGTGAGTCGGATGCTGCTGG + Intergenic
948941963 2:241201215-241201237 GAAGGTTTGGAGGAAGCTGCGGG - Intronic
949064854 2:241983817-241983839 GATGGTTTGCAGGTTGCTCCGGG + Intergenic
1169129033 20:3154039-3154061 AAGAGTTCGCAGGATGCTCCAGG + Intronic
1172060535 20:32184294-32184316 AGGGGAATGCAGGATGCAGCTGG + Intergenic
1175466096 20:59192095-59192117 AAGGCTGTGCAGGGGGCTGCAGG - Exonic
1176590593 21:8646244-8646266 AAGAGTTTGCAGGAATCTGGAGG + Intergenic
1177886630 21:26754973-26754995 ATGGGCTTGCAACATGCTGCAGG + Intergenic
1180273422 22:10623277-10623299 AAGAGTTTGCAGGAATCTGGAGG + Intergenic
1180439550 22:15351546-15351568 ACAGGATTCCAGGATGCTGCTGG - Intergenic
1181371329 22:22420227-22420249 AAGGGTGTCCTGGATGCTGTGGG - Intergenic
1182706373 22:32283133-32283155 AAGGGGTTGCAGAATGCAGAAGG - Intergenic
1183254472 22:36753519-36753541 AAGGGTTTCCAGGACCTTGCAGG - Intergenic
1183607210 22:38872655-38872677 AACTGTTTGCAGGCTGCTGCGGG - Intergenic
1184681548 22:46074841-46074863 AAGGGTCTCCAGGGTGCTGATGG + Intronic
1185077365 22:48690549-48690571 AAGGGCCTGCAGGAGGATGCAGG - Intronic
1185398929 22:50606049-50606071 GAGGGTCTGGGGGATGCTGCAGG + Intronic
950460760 3:13121008-13121030 AAGGGGTTGCAGGGTGCTGCTGG - Intergenic
952495048 3:33908503-33908525 AAGGGTCTTCTGGATGCAGCTGG - Intergenic
953493299 3:43367097-43367119 AGGGACTTGCAGGAAGCTGCAGG - Intronic
957665785 3:83224311-83224333 AAAGTTTTTCAGGATGCTGCAGG - Intergenic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
962284597 3:134075528-134075550 AAGGGCCAGCAGGATGCTGATGG - Intronic
962745779 3:138396467-138396489 AGGTGCTTGGAGGATGCTGCAGG + Intronic
962986467 3:140540710-140540732 AAGTGTGTTCAGGATGCTGCTGG - Intronic
963123611 3:141795924-141795946 GGGGGTCTGCAGGATGCGGCAGG + Intronic
963462138 3:145628896-145628918 AGGGGTTTGCAGGAAGCTAGAGG - Intergenic
963755583 3:149232017-149232039 AAGTATTTGCAGGATGGTGGTGG + Intergenic
967037927 3:185662010-185662032 GAGGGTTAGCAGGATGTGGCGGG + Intronic
969015346 4:4100131-4100153 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
972558823 4:40207475-40207497 GATGGTTTTCAGGATGCAGCAGG + Intronic
973007469 4:45030457-45030479 CAGGGTCTGCAGGATGCACCCGG + Intergenic
978954255 4:114595632-114595654 AAGGGGTTGCAGGATGGTCACGG - Intergenic
982435954 4:155383561-155383583 AAGGTTTTTCAGCATGCAGCAGG - Intergenic
983209484 4:164944210-164944232 AAGGGTATACAGGATGCTATGGG + Intergenic
984705447 4:182844333-182844355 ATGGGTTTGCAGGTTGCTGCAGG + Intergenic
991927612 5:71720070-71720092 ATGGGCTTGCAGGATTCTGTGGG + Intronic
993201728 5:84825344-84825366 TAGGATTTGAAGAATGCTGCTGG - Intergenic
993452933 5:88094826-88094848 ATCAGTTTGCAGCATGCTGCTGG + Intergenic
995945421 5:117639243-117639265 AAGGGTTTACAGTTTTCTGCAGG - Intergenic
996664499 5:126043129-126043151 AATGGTGTGGAGGTTGCTGCAGG - Intergenic
997634893 5:135398249-135398271 GTGAGTGTGCAGGATGCTGCTGG - Intronic
1003563616 6:7203999-7204021 CAGGGCTCGCAGGATGCTCCTGG - Intronic
1003572694 6:7266397-7266419 AAGAGGTTGGAGGAAGCTGCTGG - Intergenic
1005835391 6:29705009-29705031 GAGGGTTTGCTGGATGCCCCCGG - Intergenic
1010481143 6:76355673-76355695 AATGCTTTGCAGGCTGCAGCAGG - Intergenic
1012550852 6:100464132-100464154 AGGGGTCTGGAGGATGCGGCTGG - Intronic
1015916181 6:138219422-138219444 ATGGGTTTGCAGGATGATTCAGG + Intronic
1015966168 6:138696910-138696932 AAGGGTTGGCAGGACCCTGATGG - Intergenic
1016504552 6:144764271-144764293 GACGGTTTGCTGGCTGCTGCAGG - Intronic
1018980295 6:168596414-168596436 ATGAGTTTCCAGGGTGCTGCTGG + Intronic
1019653332 7:2172624-2172646 ACGGCTTTGCTGGATGCTGCTGG - Intronic
1019677544 7:2323580-2323602 AAGGATCTGGAGGATGCTGCAGG + Intronic
1020270295 7:6590607-6590629 AAGGGTTTGGGGGCTGCTGCAGG - Intronic
1020498633 7:8888969-8888991 ATGGATTTGCAAGATGCTACTGG - Intergenic
1020499585 7:8899940-8899962 TAGAGTTTGCATGATGCAGCAGG - Intergenic
1020945556 7:14601120-14601142 AAAGGTTTGCAGCATCCAGCTGG - Intronic
1021304008 7:19009200-19009222 AAAAGTTTGCAGGCTGCTTCCGG + Intergenic
1022212516 7:28225380-28225402 CAGGGTTTGGAGGACTCTGCAGG + Intergenic
1022831489 7:34071982-34072004 ACAAGTTTGCAGGATGCTGTGGG + Intronic
1022943759 7:35262169-35262191 CAGGGCTTGCAGGATGGCGCCGG + Intergenic
1024829453 7:53432495-53432517 AAGCGTATGCACAATGCTGCAGG + Intergenic
1025810979 7:64875302-64875324 AAGGATCCGCAGGATGCTTCAGG + Intronic
1025811378 7:64877794-64877816 AAGGATCCGCAGGATGCTTCAGG + Intronic
1026933804 7:74240137-74240159 AAGAGCTAGCAGGATGATGCCGG - Intronic
1029074011 7:97921791-97921813 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1031516666 7:122709160-122709182 AAGGTTCTGCAGGCTGCTTCTGG + Intronic
1033800055 7:144890493-144890515 AAGGGTGTGAAGGATACTGATGG + Intergenic
1034104810 7:148481381-148481403 GATGGTTGGCAGGATGCTGGAGG - Intergenic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1034300688 7:150012849-150012871 ATGTGTTTGCAGGATGAGGCTGG + Intergenic
1034935246 7:155195006-155195028 AGGGGTGTGGAGGGTGCTGCTGG + Intergenic
1035302887 7:157908568-157908590 AAGGGATTGTGGGGTGCTGCGGG - Intronic
1036243692 8:7099504-7099526 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1036257109 8:7214553-7214575 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036309159 8:7673152-7673174 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036360376 8:8072967-8072989 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1036694334 8:10964828-10964850 AGGGCTTTAGAGGATGCTGCAGG - Intronic
1036813714 8:11885878-11885900 GGGGGCTTGCAGGAGGCTGCAGG - Intergenic
1036890593 8:12594000-12594022 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036898147 8:12651920-12651942 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1037129395 8:15389405-15389427 AACAGTCTGCAGGTTGCTGCTGG - Intergenic
1037849943 8:22319254-22319276 AAGTATTTGCAGGATGCTATAGG - Intronic
1039480251 8:37867868-37867890 AAAGGTTTACAGGAAGCTGGAGG - Intronic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1040942271 8:52845549-52845571 AAGATTTTACAGCATGCTGCTGG + Intergenic
1042810471 8:72820075-72820097 AAGGCTTTGCAGTAAGCTGAAGG - Intronic
1043861116 8:85318292-85318314 AAGGGTTTGAAAGCTGCTGTGGG - Intergenic
1044225956 8:89718324-89718346 AAGGGTTCTAAGGATGCTGTTGG + Intergenic
1045223059 8:100217125-100217147 AAGGGGTTTCACCATGCTGCAGG + Intronic
1045590823 8:103594654-103594676 AAGGGAATGCAGATTGCTGCTGG + Intronic
1046474942 8:114729952-114729974 AAGGTTTTGTAAGATGCTGAAGG - Intergenic
1048344688 8:133567805-133567827 GAGGGTTTTGAGGATGATGCTGG + Intronic
1049477272 8:142802565-142802587 AAAGGATTGCAGGAAGCTCCAGG + Intergenic
1059348299 9:113647141-113647163 AAGCATTTGCAGGCAGCTGCGGG + Intergenic
1060153030 9:121300705-121300727 CAGGGTCTGCAGGAGGCTGTTGG - Intronic
1061363049 9:130155874-130155896 GAGCCTTTGCAGGATCCTGCGGG - Intergenic
1062026578 9:134343414-134343436 CAGGGGCTGCAGGATGCTGACGG - Intronic
1203620606 Un_KI270749v1:124968-124990 AAGAGTTTGCAGGAATCTGGAGG + Intergenic
1187232393 X:17435325-17435347 AAGGCTTTCCAGGTTGCTGAAGG + Intronic
1187536772 X:20148078-20148100 AAGGAAGTGCAGGATGCTGTAGG - Intergenic
1188209447 X:27404228-27404250 AAGGGTTTGGAGGTTGGAGCTGG + Intergenic
1189774942 X:44462222-44462244 AAGGGTCTGAAGGCTGCAGCTGG - Intergenic
1193198774 X:78663500-78663522 AAAGGTTTGCAGACTGCTGAAGG + Intergenic
1197751267 X:129965277-129965299 AAGGCTTTGCAGGATCCTGAAGG - Intergenic
1199895002 X:152119527-152119549 CAGGGTTGGCAGGGTGCTGGGGG + Intergenic
1200700102 Y:6394849-6394871 AAGGGTCTGCAAGATGCTTCAGG - Intergenic
1200919382 Y:8599585-8599607 AAGGATTTGTAGAATGCAGCAGG + Intergenic
1200927704 Y:8669373-8669395 AAGGATCTGCAGGATGCCTCAGG + Intergenic
1200984953 Y:9294454-9294476 AAGGATCTGCAGGATGCCTCAGG - Intergenic
1201034009 Y:9769849-9769871 AAGGGTCTGCAAGATGCTTCAGG + Intergenic
1201730071 Y:17193152-17193174 AGGGGCCTGCAGGAAGCTGCAGG + Intergenic
1202129456 Y:21596729-21596751 AAGGATCTGCAGGATGCCTCAGG + Intergenic
1202175932 Y:22098942-22098964 AAGGATTTGCAGGATTCCTCAGG - Intergenic
1202181627 Y:22144860-22144882 AAGGATCTGCAGGATGCCTCAGG - Intergenic
1202181943 Y:22147304-22147326 AAGGATCTGCAGGATGCTTCAGG - Intergenic
1202209417 Y:22439098-22439120 AAGGATCTGCAGGATGCTTCAGG + Intergenic
1202209733 Y:22441542-22441564 AAGGATCTGCAGGATGCCTCAGG + Intergenic
1202215429 Y:22487442-22487464 AAGGATTTGCAGGATTCCTCAGG + Intergenic