ID: 1122276780

View in Genome Browser
Species Human (GRCh38)
Location 14:100594759-100594781
Sequence GGTGATGCATAAAGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122276780_1122276786 -4 Left 1122276780 14:100594759-100594781 CCCAGAGCCCTTTATGCATCACC No data
Right 1122276786 14:100594778-100594800 CACCATGGGTCCAGCTCCCCTGG No data
1122276780_1122276794 21 Left 1122276780 14:100594759-100594781 CCCAGAGCCCTTTATGCATCACC No data
Right 1122276794 14:100594803-100594825 TCTCAACCCCACCTTATAGGTGG No data
1122276780_1122276793 18 Left 1122276780 14:100594759-100594781 CCCAGAGCCCTTTATGCATCACC No data
Right 1122276793 14:100594800-100594822 GGATCTCAACCCCACCTTATAGG No data
1122276780_1122276787 -3 Left 1122276780 14:100594759-100594781 CCCAGAGCCCTTTATGCATCACC No data
Right 1122276787 14:100594779-100594801 ACCATGGGTCCAGCTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122276780 Original CRISPR GGTGATGCATAAAGGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr