ID: 1122277471

View in Genome Browser
Species Human (GRCh38)
Location 14:100602127-100602149
Sequence TTTACTTTGTTAGGTGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122277467_1122277471 12 Left 1122277467 14:100602092-100602114 CCGGTAATTTTTGATTGGATGCC No data
Right 1122277471 14:100602127-100602149 TTTACTTTGTTAGGTGTTGGAGG No data
1122277464_1122277471 26 Left 1122277464 14:100602078-100602100 CCTTCTTTTTATGCCCGGTAATT No data
Right 1122277471 14:100602127-100602149 TTTACTTTGTTAGGTGTTGGAGG No data
1122277466_1122277471 13 Left 1122277466 14:100602091-100602113 CCCGGTAATTTTTGATTGGATGC 0: 11
1: 40
2: 95
3: 199
4: 403
Right 1122277471 14:100602127-100602149 TTTACTTTGTTAGGTGTTGGAGG No data
1122277468_1122277471 -9 Left 1122277468 14:100602113-100602135 CCAGACATTGTAATTTTACTTTG No data
Right 1122277471 14:100602127-100602149 TTTACTTTGTTAGGTGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122277471 Original CRISPR TTTACTTTGTTAGGTGTTGG AGG Intergenic
No off target data available for this crispr