ID: 1122278001

View in Genome Browser
Species Human (GRCh38)
Location 14:100605105-100605127
Sequence CCTGGTCTCCACAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122277990_1122278001 23 Left 1122277990 14:100605059-100605081 CCGGGTGAGGCTGTGGAAGCTGC No data
Right 1122278001 14:100605105-100605127 CCTGGTCTCCACAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122278001 Original CRISPR CCTGGTCTCCACAGGGAGGA GGG Intergenic
No off target data available for this crispr