ID: 1122281100

View in Genome Browser
Species Human (GRCh38)
Location 14:100622895-100622917
Sequence GATCAAATGCAGAATGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122281093_1122281100 21 Left 1122281093 14:100622851-100622873 CCTCAGTCTGAAAAGGGAGATAA No data
Right 1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG No data
1122281097_1122281100 -10 Left 1122281097 14:100622882-100622904 CCTCAAGGGCGCGGATCAAATGC No data
Right 1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG No data
1122281092_1122281100 22 Left 1122281092 14:100622850-100622872 CCCTCAGTCTGAAAAGGGAGATA No data
Right 1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122281100 Original CRISPR GATCAAATGCAGAATGTGGG TGG Intergenic
No off target data available for this crispr