ID: 1122281763

View in Genome Browser
Species Human (GRCh38)
Location 14:100627648-100627670
Sequence CTCAAAGAGAAGAGGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122281763_1122281768 13 Left 1122281763 14:100627648-100627670 CCCTGCCTCCTCTTCTCTTTGAG No data
Right 1122281768 14:100627684-100627706 CACCTTTAACAGTCCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122281763 Original CRISPR CTCAAAGAGAAGAGGAGGCA GGG (reversed) Intergenic
No off target data available for this crispr