ID: 1122285910

View in Genome Browser
Species Human (GRCh38)
Location 14:100652533-100652555
Sequence CTGTGGGTCTAGTGGCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122285900_1122285910 7 Left 1122285900 14:100652503-100652525 CCCCTGCAGCATGCTGGGATTGG No data
Right 1122285910 14:100652533-100652555 CTGTGGGTCTAGTGGCAACAGGG No data
1122285903_1122285910 5 Left 1122285903 14:100652505-100652527 CCTGCAGCATGCTGGGATTGGAG No data
Right 1122285910 14:100652533-100652555 CTGTGGGTCTAGTGGCAACAGGG No data
1122285902_1122285910 6 Left 1122285902 14:100652504-100652526 CCCTGCAGCATGCTGGGATTGGA No data
Right 1122285910 14:100652533-100652555 CTGTGGGTCTAGTGGCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122285910 Original CRISPR CTGTGGGTCTAGTGGCAACA GGG Intergenic
No off target data available for this crispr