ID: 1122286921

View in Genome Browser
Species Human (GRCh38)
Location 14:100657817-100657839
Sequence ACACCGAGTGTCCACCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122286921_1122286927 7 Left 1122286921 14:100657817-100657839 CCTTTAAGGTGGACACTCGGTGT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1122286927 14:100657847-100657869 GGGAGGCAAGAGTGAAGCAGAGG 0: 1
1: 0
2: 4
3: 71
4: 660
1122286921_1122286928 20 Left 1122286921 14:100657817-100657839 CCTTTAAGGTGGACACTCGGTGT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1122286928 14:100657860-100657882 GAAGCAGAGGAGAGCAAGCGTGG 0: 1
1: 0
2: 4
3: 42
4: 453
1122286921_1122286926 -10 Left 1122286921 14:100657817-100657839 CCTTTAAGGTGGACACTCGGTGT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1122286926 14:100657830-100657852 CACTCGGTGTGGGCAGTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 254
1122286921_1122286929 23 Left 1122286921 14:100657817-100657839 CCTTTAAGGTGGACACTCGGTGT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1122286929 14:100657863-100657885 GCAGAGGAGAGCAAGCGTGGTGG 0: 1
1: 0
2: 2
3: 38
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122286921 Original CRISPR ACACCGAGTGTCCACCTTAA AGG (reversed) Intergenic
901923318 1:12550915-12550937 AACCCGAGTGGCCACCTTTAGGG - Intergenic
902846816 1:19117376-19117398 GTACCGCGTGTCCACTTTAATGG + Exonic
903385532 1:22923933-22923955 TCACAGACTGTCCTCCTTAAGGG - Intergenic
911803814 1:102179371-102179393 ACACCGAGAATGAACCTTAATGG - Intergenic
917765973 1:178217464-178217486 ACACCAAGAGTGAACCTTAATGG - Intronic
918462455 1:184790351-184790373 ACACCAAGTGTCCCCCTCACTGG + Intergenic
918720429 1:187845665-187845687 ACCCCAAGTGTCCACCAAAAGGG + Intergenic
918756259 1:188342088-188342110 ACACTGAGTGTCCACTTGATTGG - Intergenic
1076543201 10:131227348-131227370 ACACCGCGTGTCCACCCAAGGGG - Intronic
1083470462 11:62880817-62880839 TCCCCGAGGTTCCACCTTAAGGG + Intronic
1086157902 11:83688110-83688132 AAACAAAGTGTCCACGTTAATGG + Intronic
1086449507 11:86901986-86902008 ACACCCAGTTTCTACCTTGAAGG - Intronic
1090530882 11:127590632-127590654 ACATCAAGTTTCCCCCTTAAAGG - Intergenic
1102195801 12:111024348-111024370 ACACCGAGTGTCCACCAGGTGGG + Intergenic
1103782535 12:123408751-123408773 ACACCCAGTGTCCTCCTGCAAGG + Exonic
1115345808 14:32342334-32342356 ACTCCCAGTCTCCACCCTAAGGG - Intronic
1118035577 14:61862646-61862668 ACACCAAGAGTGAACCTTAATGG - Intergenic
1118377050 14:65186613-65186635 ACACCTAGACTCCACCTTTATGG - Intergenic
1119880199 14:78093712-78093734 ACAGGGAGTGTCCACATTACCGG - Intergenic
1120227174 14:81803767-81803789 AAACCAAGGGTCCACCTAAAAGG - Intergenic
1120265192 14:82239663-82239685 AGACAGAGTGTCTCCCTTAAGGG - Intergenic
1122286921 14:100657817-100657839 ACACCGAGTGTCCACCTTAAAGG - Intergenic
1129274404 15:74435478-74435500 AAACCGAATGTCCATCTTAGAGG - Intergenic
1132483378 16:177405-177427 CCACCGAGGCTCCAGCTTAACGG - Exonic
1135119736 16:19755476-19755498 ACACCTAGAGACAACCTTAAAGG + Intronic
1139717262 16:68823487-68823509 AGACCAAGTGACCACCTTAGAGG + Exonic
1144590182 17:16517077-16517099 ACACAGAATGATCACCTTAACGG - Intergenic
1146634386 17:34493324-34493346 ACTCCCAGTGTCCACCTCCAAGG + Intergenic
1151335591 17:73437893-73437915 ACGGCGAGGGTCCTCCTTAAGGG - Intronic
1153431880 18:5026474-5026496 ACCCCGTGTTTCCACCTTACAGG + Intergenic
1158767529 18:60472614-60472636 ATACCAAGTGTCCAGATTAATGG - Intergenic
1160833841 19:1115589-1115611 ACCCCGCGTGTCCACCATACTGG - Intronic
928160969 2:28924204-28924226 ACACCCAGTGTCCAGGTTGATGG - Intronic
932218411 2:69982156-69982178 TCACAGAGTGTCCACTTCAAAGG - Intergenic
939245858 2:139622736-139622758 TCAGCGTGTGTCCCCCTTAAAGG - Intergenic
945451959 2:210004097-210004119 ACCCTGAGTGTCTACCTCAAAGG + Intronic
1175434622 20:58935413-58935435 ACAGCGAGTGTTCTACTTAATGG + Intergenic
1176079449 20:63264707-63264729 ACTCGGAGTGTCCCCCTTCAAGG - Intronic
1176239890 20:64070989-64071011 ACACTCAGTGTCCACCTCCATGG - Intronic
1179073482 21:38095021-38095043 ACACTGAGTGCTCAGCTTAAGGG - Intronic
1184529887 22:45048684-45048706 ACACCAAGTGTCCACCATGTGGG - Intergenic
949139998 3:620516-620538 ACACTGAGTGTCAACCTGATTGG + Intergenic
956277401 3:67517454-67517476 ACTCAGAGAGGCCACCTTAATGG - Intronic
960201512 3:114842490-114842512 ACACCAAGTCTCTACCTTCACGG + Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
966731561 3:183155737-183155759 ACACACAGTTTCCACCTTCACGG - Intronic
971288723 4:25315044-25315066 AAACCAAGTATTCACCTTAATGG - Intronic
975018590 4:69457876-69457898 ATACTGATGGTCCACCTTAAGGG + Intergenic
975635901 4:76447883-76447905 ACACCAACTGTCCTTCTTAAAGG - Intronic
976431981 4:84972794-84972816 AAACCTACTGTCCACCTTTATGG + Intergenic
981312551 4:143311381-143311403 ACACAGAGTGTCTATTTTAAAGG + Intergenic
986794617 5:11197329-11197351 ACAACCACTGTCCATCTTAACGG + Intronic
998939563 5:147266639-147266661 ACACCCAGTGTCTTCCTTCATGG + Intronic
1004235134 6:13868463-13868485 ACAGCAAGTGGCCACATTAAGGG - Intergenic
1009295224 6:61938878-61938900 GCACCAAGTGTCCTCCTCAAGGG + Intronic
1016147751 6:140696354-140696376 ACACTGAGTGTCAACCTGATTGG - Intergenic
1018384439 6:163290329-163290351 TCACTGAGTGACCATCTTAATGG + Intronic
1020636567 7:10702613-10702635 CCACTGACTTTCCACCTTAATGG - Intergenic
1029086831 7:98018440-98018462 TCAATGCGTGTCCACCTTAATGG + Intergenic
1032782910 7:135178416-135178438 ACACACAGTGATCACCTTAATGG + Intergenic
1035745997 8:1962443-1962465 ACACCGAGTGTCCAGCCTGCCGG + Intergenic
1043257556 8:78155690-78155712 ATACTGAGTGTCAACCTGAATGG + Intergenic
1057336284 9:94157872-94157894 ACCCTGAGTGTCCACCTATAAGG - Intergenic
1203617378 Un_KI270749v1:79722-79744 ACACTGAGTGTCAACCTGATTGG - Intergenic
1189113602 X:38320773-38320795 AACCTGTGTGTCCACCTTAAGGG - Intronic