ID: 1122289419

View in Genome Browser
Species Human (GRCh38)
Location 14:100672186-100672208
Sequence CTGTGGCACAAGAGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122289419_1122289427 24 Left 1122289419 14:100672186-100672208 CCTCCTGCCCTCTTGTGCCACAG 0: 1
1: 0
2: 2
3: 24
4: 328
Right 1122289427 14:100672233-100672255 CCCCAGAGGTCCTGTGGCCAAGG 0: 1
1: 0
2: 2
3: 32
4: 267
1122289419_1122289424 10 Left 1122289419 14:100672186-100672208 CCTCCTGCCCTCTTGTGCCACAG 0: 1
1: 0
2: 2
3: 24
4: 328
Right 1122289424 14:100672219-100672241 GCTAAAGCAATGTTCCCCAGAGG 0: 1
1: 0
2: 1
3: 3
4: 126
1122289419_1122289425 18 Left 1122289419 14:100672186-100672208 CCTCCTGCCCTCTTGTGCCACAG 0: 1
1: 0
2: 2
3: 24
4: 328
Right 1122289425 14:100672227-100672249 AATGTTCCCCAGAGGTCCTGTGG 0: 1
1: 0
2: 3
3: 29
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122289419 Original CRISPR CTGTGGCACAAGAGGGCAGG AGG (reversed) Intergenic
900571692 1:3361795-3361817 CTGCGGTCCAGGAGGGCAGGTGG + Intronic
900571699 1:3361828-3361850 CTGTGGCCCAGGAGGGCAGGTGG + Intronic
900571717 1:3361898-3361920 CTGCGGTCCAGGAGGGCAGGTGG + Intronic
900571725 1:3361931-3361953 CCGCGGCCCAGGAGGGCAGGTGG + Intronic
900571734 1:3361964-3361986 CCGTGGCCCAGGAGGGCAGGTGG + Intronic
900571743 1:3361997-3362019 CCGTGGCCCAGGAGGGCAGGTGG + Intronic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
904808099 1:33145808-33145830 CTGTGGCAGAAAAACGCAGGTGG + Exonic
907272854 1:53300888-53300910 CTGAGGCACCAGAGGGTAAGGGG - Intronic
907285748 1:53378380-53378402 ATGTGGCAGAACAAGGCAGGAGG + Intergenic
907456616 1:54580471-54580493 CTGGGGCAAATGAGAGCAGGTGG - Intronic
909320561 1:74280465-74280487 CTGTGCCACTAGTGGGGAGGTGG - Intronic
909457423 1:75866174-75866196 CTGTCTCAAAAAAGGGCAGGGGG - Intronic
912046094 1:105459755-105459777 CTGTGGCAAGAGTGGTCAGGAGG - Intergenic
912314779 1:108657916-108657938 CTGTGGTCCAAGTAGGCAGGAGG + Intronic
915732749 1:158065834-158065856 CTGAGGGGAAAGAGGGCAGGCGG - Intronic
916763014 1:167833860-167833882 CTGTGGCAAGAGATGGGAGGAGG + Intronic
917504216 1:175613567-175613589 CTCTGGAATCAGAGGGCAGGAGG - Intronic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922690473 1:227685177-227685199 CTTAGGCACAAGAGGGCTCGTGG + Intergenic
922953826 1:229582279-229582301 CTGTGCCAGAACAGTGCAGGAGG - Intergenic
923431057 1:233920786-233920808 ATGTGGCAAAGGATGGCAGGCGG + Intronic
924773330 1:247095932-247095954 CTGTGGCACAAGGGGGCCATAGG + Intergenic
1063112960 10:3052777-3052799 CTGTGGGACAAGAGTGCAACAGG + Intergenic
1063298353 10:4828302-4828324 CTGAAGCACAAGAGAGCAAGGGG + Intronic
1063949502 10:11208800-11208822 CTGAGAGACAGGAGGGCAGGAGG + Intronic
1067424755 10:46198260-46198282 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1067442617 10:46318092-46318114 CTGGGGCAGAGGAGGGGAGGTGG + Intronic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1067793252 10:49303239-49303261 CTTCCGCACAAGAGGGGAGGTGG - Intronic
1068345319 10:55770447-55770469 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1070861238 10:79664504-79664526 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1070876015 10:79811091-79811113 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071642948 10:87333225-87333247 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1073438281 10:103535701-103535723 CTCTGGCCCAAGGGGGCAGAAGG + Intronic
1074183424 10:111082230-111082252 CCGTGGCACCACAGGCCAGGAGG - Intergenic
1075454049 10:122573475-122573497 CTGTGGCAGCAGAGGACATGGGG + Intronic
1075856021 10:125630909-125630931 CTGTAGCACAGATGGGCAGGAGG + Intronic
1076220119 10:128727200-128727222 AGGTGGAACAAGAGGGCAGGAGG - Intergenic
1076583367 10:131529933-131529955 CTGGGGCCAATGAGGGCAGGAGG + Intergenic
1078809716 11:14746293-14746315 CTGAGGCACAAGAACCCAGGAGG + Intronic
1081581063 11:44352339-44352361 CTGTGGCAGAAGGGAGCAGACGG + Intergenic
1082076253 11:47978477-47978499 CTCTGCCTCAAGAGGGGAGGAGG + Intergenic
1083018198 11:59478109-59478131 CTCAGGCAGGAGAGGGCAGGAGG + Exonic
1083268814 11:61560331-61560353 CTGTGGCTGAAGAGGGCTTGAGG - Intronic
1083304714 11:61756336-61756358 CTCTGCCTCCAGAGGGCAGGAGG + Intronic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084972185 11:72777930-72777952 CTGAGGCAGGAGAGGGGAGGGGG + Intronic
1085313705 11:75531013-75531035 CTGTGGCCCAAGTGGGTGGGAGG + Intergenic
1085811461 11:79686211-79686233 TTGTGGCATAGCAGGGCAGGTGG + Intergenic
1085928150 11:81047177-81047199 CTGGGGCTCAAGATGGCTGGTGG + Intergenic
1086587644 11:88474117-88474139 CTGGGGAACAAGGGGGCAGCAGG - Intergenic
1087147483 11:94826518-94826540 CTGTGTCACAACATGGCAGAAGG + Intronic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1089528515 11:119112305-119112327 CTGTGGGACAAGAGGAGATGGGG - Intronic
1089628761 11:119770412-119770434 ATGTGACACTGGAGGGCAGGGGG - Intergenic
1089771826 11:120808686-120808708 CTTTGGCACAAGAGAGGAGATGG + Intronic
1090250297 11:125246234-125246256 CTGTGTCATAACATGGCAGGAGG + Intronic
1090627362 11:128618601-128618623 CTGTGGCAGAAAAGCACAGGAGG + Intergenic
1091262425 11:134245264-134245286 GTGTGGGCCAAAAGGGCAGGTGG - Intronic
1091699099 12:2648363-2648385 CAGTGGCAGAAGAGGGCAAAAGG - Intronic
1091702688 12:2674314-2674336 ACGGGGCACAAGAGGGAAGGGGG + Intronic
1092046080 12:5432628-5432650 CCGAGGGACAAGAGGGGAGGAGG - Intronic
1092126619 12:6079247-6079269 CTGTGGCAGAACAGGGAAGCTGG - Intronic
1092899431 12:13044600-13044622 CTGTGCCACCAGAGGGCGAGAGG + Intronic
1095403205 12:41838885-41838907 CTGTCACACAAGAGGCCATGGGG + Intergenic
1096214277 12:49791045-49791067 CTGTGTCACAAGGGGGCCTGGGG + Intergenic
1096404389 12:51332767-51332789 CTGAGGCACAAGAACCCAGGAGG + Intronic
1096626674 12:52900066-52900088 CTGTGGGGGAAGAGGGCAAGTGG + Intronic
1097714104 12:62947263-62947285 CTGTGTCATAACAGGGCAGAAGG + Intergenic
1097897798 12:64843010-64843032 CTGTCTCAAAAAAGGGCAGGGGG - Intronic
1099637622 12:85234613-85234635 CCCTGGCACAAGTGGGCAAGTGG - Intronic
1099668626 12:85661646-85661668 CTGATGAACAAGTGGGCAGGGGG - Intergenic
1100414096 12:94354278-94354300 CTGAGGCACAAGAACCCAGGAGG - Intronic
1100532667 12:95474509-95474531 CTGTGGGACTAGAGGGCTGGTGG + Intronic
1101074500 12:101114608-101114630 CTGTGAGATAAGAGTGCAGGAGG + Intronic
1101416554 12:104513576-104513598 CTGTAACACCAAAGGGCAGGAGG + Intronic
1102967398 12:117138723-117138745 CTGAGACACAAGAGCCCAGGAGG + Intergenic
1104877284 12:132044328-132044350 CAGGGGGGCAAGAGGGCAGGAGG - Intronic
1105451248 13:20502262-20502284 CTGTCGCACAGGAGGGCTGTGGG + Intronic
1105550838 13:21394380-21394402 CGGTGGCATGATAGGGCAGGTGG - Intronic
1106199796 13:27526850-27526872 CTGTGTCACAACATGGCAGAAGG - Intergenic
1107023237 13:35773503-35773525 CTGGGGCACAAGGGGACTGGAGG - Exonic
1109248632 13:59989764-59989786 CTGTGCCCCAAGAGAGCATGTGG - Intronic
1112310380 13:98312895-98312917 ATTTGGCTAAAGAGGGCAGGAGG + Intronic
1112326471 13:98445504-98445526 CTGGGCCACTAGAGGGCATGTGG + Intronic
1112505241 13:99971140-99971162 GTGTAGCCCGAGAGGGCAGGAGG + Exonic
1112908133 13:104449022-104449044 CAGTGAAACAAGAAGGCAGGTGG - Intergenic
1114912959 14:27223447-27223469 GTGTGGCATGACAGGGCAGGGGG - Intergenic
1115056105 14:29129160-29129182 CTAGGCCAAAAGAGGGCAGGGGG - Intergenic
1115289435 14:31753260-31753282 CAGTGGCAGAAGGTGGCAGGTGG + Intronic
1115647996 14:35383694-35383716 CAGTGGGACAAGATGGCTGGTGG + Intergenic
1115664668 14:35534214-35534236 CTCTGGGACAAGAGGAAAGGGGG - Exonic
1116764320 14:49051791-49051813 TTGTGGCAGAAGAGGGCTGGAGG - Intergenic
1117526927 14:56618054-56618076 CTGTGGCACCAGTGGGGTGGGGG - Intronic
1118973099 14:70653965-70653987 CTGATGCACAAGAGGGTGGGTGG - Intronic
1121014474 14:90539953-90539975 CTGTGGCCCATGAGTGCAGGAGG + Exonic
1121625680 14:95384076-95384098 CTCTGGGACAAGGGGACAGGAGG + Intergenic
1121626764 14:95390876-95390898 CTGTGGCACCACATGGCAGAAGG - Intergenic
1122213393 14:100187687-100187709 CTGTGGCTCAAGAGGGCCCCAGG + Intergenic
1122289419 14:100672186-100672208 CTGTGGCACAAGAGGGCAGGAGG - Intergenic
1122596793 14:102899350-102899372 CTGCTGCTCAAGAGGGTAGGCGG - Intronic
1124367321 15:29081292-29081314 CTGTGGGACCAGAGGGGATGTGG + Intronic
1125403448 15:39328741-39328763 CTTGGGAACAACAGGGCAGGTGG - Intergenic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128307483 15:66609175-66609197 CTGTGGCACCAGCCCGCAGGTGG + Intronic
1129375276 15:75126360-75126382 CTGGGGTACTAGGGGGCAGGTGG - Intergenic
1131460663 15:92615483-92615505 CTGTGGCACCACCGGGCTGGAGG + Intergenic
1132408822 15:101561525-101561547 CTGGGGGACAAGGGAGCAGGCGG + Intergenic
1132506900 16:314837-314859 CAGAGGGACAAGAGGACAGGTGG - Intronic
1132575820 16:663526-663548 CTGAGGCTCAAGAGGTCAGGAGG + Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1134104646 16:11477020-11477042 CTGTGGCTCAGGACTGCAGGGGG - Intronic
1134833861 16:17345422-17345444 CTGTGGCACAGGGATGCAGGAGG + Intronic
1136293975 16:29291405-29291427 CTGCGGCACAGAGGGGCAGGGGG + Intergenic
1136294150 16:29292123-29292145 GTGAGGCTCAGGAGGGCAGGGGG + Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1138307057 16:55988051-55988073 CTGTGTCATAACAGGGCAGAAGG - Intergenic
1138914028 16:61440701-61440723 CTATTGCACAGGAGGTCAGGAGG + Intergenic
1139485352 16:67253116-67253138 ATGTGGTAACAGAGGGCAGGAGG - Intronic
1140215955 16:73008813-73008835 CTGTGACTAAAGAAGGCAGGAGG + Intronic
1140456323 16:75107643-75107665 CTGCATCCCAAGAGGGCAGGCGG - Intronic
1141480716 16:84304863-84304885 CTGGGCCACAGGAGGGCAGAGGG + Intronic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142099879 16:88265451-88265473 CTGCGGCACAGAGGGGCAGGGGG + Intergenic
1142100054 16:88266169-88266191 GTGAGGCTCAGGAGGGCAGGGGG + Intergenic
1142109503 16:88323686-88323708 GAGTGGCAGAAGTGGGCAGGGGG + Intergenic
1142292625 16:89199949-89199971 CTGAGGCATGAGAGGGCAAGGGG + Intronic
1143279260 17:5739065-5739087 ATGTGACACAAGAAGGCAGAGGG + Intergenic
1146289456 17:31597291-31597313 GTGTGGGGCAAGATGGCAGGTGG - Intergenic
1146610313 17:34299153-34299175 CTGTGGCACAAGAGATCCTGTGG - Intergenic
1146980866 17:37160228-37160250 CTGATGCACAAAAGAGCAGGAGG + Intronic
1147169440 17:38609403-38609425 CTGGGGCACAAGAGGGGTGGGGG + Intergenic
1147456874 17:40543333-40543355 CTGTGACACACGAGGACAGAAGG - Intergenic
1147717415 17:42517683-42517705 CTGTGGCCCAGGACTGCAGGAGG + Intronic
1148042662 17:44721221-44721243 CTGTCGCAAAAAAGGGGAGGGGG - Intronic
1148688400 17:49513279-49513301 GTGTGGGAGAAGGGGGCAGGTGG - Exonic
1149601812 17:57898302-57898324 TTGGGGCACAACAGGGCTGGGGG + Intronic
1150503396 17:65673326-65673348 ATGTGGCAAAAGAGGGCGGGGGG - Intronic
1150789943 17:68195833-68195855 CTGGGGCCCCTGAGGGCAGGGGG + Intergenic
1152526066 17:80888958-80888980 CGTGGGCACAAGAGGCCAGGAGG + Intronic
1152817200 17:82415023-82415045 CTGGGGCACAGGACGGCAGAAGG + Intronic
1153246124 18:3074207-3074229 CTGGGGCACCAGAGGTCAAGGGG - Intronic
1155214209 18:23628742-23628764 CTGAGGCACAAGAACCCAGGAGG + Intronic
1155575614 18:27242849-27242871 CTGGGTCACAGGAGGGCATGGGG + Intergenic
1157191506 18:45586027-45586049 CGGTGCCACAGGAGGGCAGAGGG - Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158499178 18:57984486-57984508 CTGTGGGACAAGAGAGCAGCTGG - Intergenic
1158884666 18:61815839-61815861 CTGTGGCTGAAGAGGGCTGCAGG - Exonic
1159232515 18:65627760-65627782 CTGTGGCAAAAAAAGGCAGGGGG - Intergenic
1160385290 18:78493056-78493078 CTGTGGCTGAGGAGGGCACGGGG + Intergenic
1160707160 19:535060-535082 CTGTGGCCCAGGAGGGCCGTGGG + Intronic
1160934604 19:1587904-1587926 CAGGGGCAGAAGAGGACAGGAGG - Intronic
1160984909 19:1834011-1834033 CTGGGCCCCAGGAGGGCAGGCGG + Intronic
1161256997 19:3315111-3315133 CTGTGGCCCACGAGGGCACCAGG + Intergenic
1162807973 19:13148776-13148798 CTGTTGCAGGAGAGGGCTGGGGG - Intronic
1162885265 19:13692373-13692395 CTGTGACTCAGGAGGGCAGGTGG + Intergenic
1163157550 19:15447767-15447789 CTGTGGAATAAGTGGGCTGGGGG + Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164650639 19:29888652-29888674 TTGTGGCTAAAGACGGCAGGTGG + Intergenic
1164952894 19:32353519-32353541 CTGTGGCAGAAATGGGTAGGAGG + Exonic
1165063362 19:33215740-33215762 GTGGGGCACCAGCGGGCAGGGGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165339522 19:35200788-35200810 CTGTGACCACAGAGGGCAGGAGG - Intergenic
1165712744 19:38023874-38023896 CTGTGTCCCAAGACGGCAGGAGG - Intronic
1166529693 19:43535006-43535028 CTGGGGGACAGGAGGGCTGGTGG - Intronic
1166955833 19:46464249-46464271 GTGAGGAGCAAGAGGGCAGGGGG - Intergenic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
925388118 2:3477109-3477131 CTGTGGCAGAGGAGGCCTGGGGG - Intronic
926141825 2:10372539-10372561 CTGTGACACAGGGGGGCAAGTGG + Intronic
926178221 2:10616316-10616338 CTGAGGCACAAGAATCCAGGAGG - Intronic
926915434 2:17886788-17886810 CTGTGGCAAAGGTGGGTAGGTGG - Intronic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
927885875 2:26718181-26718203 CTGTGGGAGATGGGGGCAGGTGG - Intronic
929875340 2:45792143-45792165 CTGTGTCACAACATGGCAGAAGG + Intronic
930406930 2:50970276-50970298 CTGAGAGAAAAGAGGGCAGGAGG + Intronic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
934657245 2:96122767-96122789 CTGGGGCCCCAGAGGGCAAGGGG + Intergenic
936075886 2:109401633-109401655 CTGTGTCCCAAGAGGGCCAGGGG + Intronic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937985715 2:127637266-127637288 CTGTGGGTGCAGAGGGCAGGTGG - Intronic
942067223 2:172283126-172283148 GTGTGGCACATGACTGCAGGGGG + Intergenic
942667180 2:178332231-178332253 CTGGGGCAGAACAGGGCAGCTGG - Intronic
944438213 2:199714685-199714707 CTGTGGCACAGGAATGCTGGGGG + Intergenic
945217398 2:207448346-207448368 ATCTGGAGCAAGAGGGCAGGGGG + Intergenic
945932299 2:215867084-215867106 CTGTGGCAGAAGAGGTGAGAGGG - Intergenic
948406574 2:237725461-237725483 ACGTGGCATAAGAGGGCAAGGGG - Intronic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
949054751 2:241921768-241921790 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
949054845 2:241922089-241922111 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
1170289421 20:14751696-14751718 CAGAAGCACAAGAGGGCAAGTGG + Intronic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1171106679 20:22440109-22440131 CTGTGGCACAGGGGAGCAGCAGG - Intergenic
1171139016 20:22724513-22724535 CAGAGGCACATCAGGGCAGGAGG + Intergenic
1171313630 20:24166884-24166906 CTGAGGCACCAGGGGCCAGGAGG - Intergenic
1173834382 20:46115698-46115720 CTGTGGCAACACAGGGGAGGAGG + Intergenic
1173920437 20:46740702-46740724 CGGTGGAACAAGATGGAAGGTGG + Intergenic
1175379833 20:58555152-58555174 CCTTGGAACAAGAGGTCAGGAGG - Intergenic
1175389047 20:58614833-58614855 CTGAGGCACAGGAGTGCAAGGGG + Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176382698 21:6121121-6121143 CTGTGGGAACAGAGGACAGGTGG - Intronic
1178678854 21:34654490-34654512 CTGTGGCACAGAGAGGCAGGTGG + Intergenic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179244969 21:39625167-39625189 CTATGGCACAAAAAGCCAGGGGG + Intronic
1179250300 21:39666392-39666414 CTGAGGCACAAGAACCCAGGAGG - Exonic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179740771 21:43417118-43417140 CTGTGGGAACAGAGGACAGGTGG + Intronic
1180935378 22:19622036-19622058 CCGCGGCAGAGGAGGGCAGGCGG - Intergenic
1181024345 22:20119400-20119422 CAGTGGCAAAAAAGGGCAGTGGG - Intronic
1181496081 22:23288340-23288362 CAGGGGAACAAGAGGGCTGGGGG - Intronic
1181960358 22:26618085-26618107 CTGTGGCACAAAGGGGAAGCTGG + Exonic
1182102018 22:27664123-27664145 CTTCAGCAGAAGAGGGCAGGAGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182428141 22:30285680-30285702 CTCGGGCACCTGAGGGCAGGTGG + Exonic
1182686486 22:32124224-32124246 CTGGGGCCCAGGAAGGCAGGTGG + Intergenic
1183379134 22:37482064-37482086 CTGAGGCATAGGAGGCCAGGAGG + Intronic
1183495853 22:38143325-38143347 GTGTGGTACAAGGTGGCAGGGGG + Intronic
1184113079 22:42406528-42406550 CTGAGGCAGAAGCGGGCATGGGG - Intronic
1184251032 22:43260459-43260481 CTGTGGCTCAAGAGGACTGCAGG - Intronic
1184610987 22:45602964-45602986 CTGGAGCAGAAGAGGGCAGGAGG + Intergenic
1184711094 22:46250015-46250037 CTGGGGCGAGAGAGGGCAGGCGG - Intronic
1185338762 22:50282479-50282501 CTGTGCCGCAAGTGGGCGGGGGG + Intronic
950096953 3:10336042-10336064 CTGGGGCACCAGAGGACATGGGG - Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
952320148 3:32269571-32269593 CTGTGGAACAAGAACTCAGGTGG + Intronic
952841976 3:37654259-37654281 CTGTGGCAGGAGAGGGCTGAAGG + Intronic
952871567 3:37905592-37905614 CTGTGGCACAAGGAGGGAGGGGG - Intronic
953829461 3:46282950-46282972 CTGTGGCAAAGTAGGTCAGGTGG + Intergenic
953845457 3:46422866-46422888 CTGTGGAACAAGGGAGCAGATGG - Intergenic
954608888 3:51933893-51933915 CTGTGTCACCAGGTGGCAGGAGG - Intronic
956059871 3:65338655-65338677 CTGGGGCACAAGAGACCAGGTGG - Intergenic
958899774 3:99872102-99872124 CTGTAGCCCAAGAATGCAGGGGG + Intronic
959465560 3:106682013-106682035 CTGTGGCACAAGAGGGATGTGGG + Intergenic
959991593 3:112637869-112637891 GTCTGGCAAAAGAGGGCAGCAGG - Intronic
960597073 3:119416003-119416025 CTGTGGATGAAGGGGGCAGGTGG - Exonic
961635578 3:128330703-128330725 CCTGGGCACAAGGGGGCAGGGGG + Intronic
961700782 3:128743101-128743123 ATGTGGCACAGGTGGGCTGGCGG + Intronic
961756646 3:129131452-129131474 ATGGGTCACAAGAGGTCAGGAGG + Intronic
962440665 3:135412742-135412764 CTGTGGCAGCCAAGGGCAGGTGG - Intergenic
963071524 3:141308907-141308929 CAGTGGGACAAAAGGGCAGCTGG - Intergenic
963273324 3:143306698-143306720 TTGAGGGACAAGAGGGCAAGCGG - Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967829842 3:193909486-193909508 CTGGGGCACTAGAGGGCTGCTGG - Intergenic
968348679 3:198033643-198033665 CTGTGGGACACCAAGGCAGGTGG - Intronic
968533935 4:1112593-1112615 CTGGGGGAGAAGCGGGCAGGCGG - Intronic
969354855 4:6619455-6619477 CTGTGGAGCAGGAGGGCTGGGGG - Intronic
969441987 4:7222711-7222733 CTGTGGCAGGAGAGAGCGGGAGG + Intronic
974557716 4:63473004-63473026 CAGTGGGACAAGCTGGCAGGTGG + Intergenic
975740160 4:77421990-77422012 CTGTTGCACAGTAGGGCAGTAGG - Intronic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
978363277 4:107953831-107953853 CTGTGGAAAAAGCTGGCAGGGGG - Intergenic
978710186 4:111770681-111770703 CTGTGGCAGCACAGGGCTGGGGG + Intergenic
980995710 4:139777858-139777880 ATGTGGCTCAAGAGAGCAGCAGG - Intronic
982968319 4:161945172-161945194 CAGTGGAAGAAGAGAGCAGGAGG - Intronic
984164333 4:176289258-176289280 GTGTGACACAAGAGGGAATGAGG - Intergenic
984717272 4:182937499-182937521 CTGCAGGACACGAGGGCAGGAGG - Intergenic
986127183 5:4893998-4894020 GTGTGGCACAAGAGGAAAGAGGG + Intergenic
991459712 5:66845023-66845045 CTGAGGCACAAGAAGAAAGGAGG + Intronic
992653230 5:78882324-78882346 CTGAGAGACAAGAGAGCAGGAGG + Intronic
997753173 5:136369642-136369664 CTGTGTCATAACAGGGCAGAAGG - Intronic
998860865 5:146442709-146442731 ATGTGGCAGAAGAGGGCGAGAGG + Intergenic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
1000006207 5:157187146-157187168 CTGTGGTAGAACAGGACAGGAGG - Intronic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1005106502 6:22229652-22229674 CTGTGGCACAAGAGTCTAAGAGG - Intergenic
1006117528 6:31783084-31783106 CTTTGGCACAGGTGGGCAAGGGG - Exonic
1007279972 6:40704369-40704391 CTGTGGCATTAGACGGCAGATGG - Intergenic
1007573096 6:42907443-42907465 CTGGGGCCCAAGAGGGATGGGGG - Intergenic
1007628133 6:43258007-43258029 CTGTTACCTAAGAGGGCAGGCGG + Intronic
1008589115 6:52975589-52975611 CTGAGGCAGAACAGGGTAGGAGG + Intergenic
1009934846 6:70221876-70221898 CTGTGGCACAAAACTGAAGGCGG + Intronic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1011631416 6:89329003-89329025 TTATGGCAGCAGAGGGCAGGGGG + Exonic
1011786692 6:90854421-90854443 CTGTGGTCCAGGAGAGCAGGTGG + Intergenic
1011788674 6:90874373-90874395 CTGAGGCACAAGGGGGTTGGGGG + Intergenic
1012668120 6:102004668-102004690 ATGTTGCACTAGAGGGCAGACGG - Intronic
1012918939 6:105200985-105201007 CTTTGGGACACCAGGGCAGGAGG - Intergenic
1013976480 6:116084584-116084606 CTGAGTCACAAGAGGCCATGAGG - Intergenic
1014943812 6:127474508-127474530 CAGAGGCCAAAGAGGGCAGGAGG - Intronic
1014960547 6:127678871-127678893 CTGTGGACCAAGAGTGCAGTTGG + Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015260106 6:131227580-131227602 CTGTAGCATAAGAGGCCAGGAGG + Intronic
1017708465 6:157146176-157146198 CTGTGGCAGAAGAGGGGAAAGGG - Intronic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019034909 6:169046562-169046584 ATGTAGAACAAGATGGCAGGAGG - Intergenic
1019062057 6:169263623-169263645 CTGAGGCACAGAAGGGCAGCTGG - Intergenic
1020026730 7:4904883-4904905 CTGTGACGCCGGAGGGCAGGGGG + Intergenic
1023987116 7:45103197-45103219 GTGTGGCATGGGAGGGCAGGGGG - Intronic
1024499942 7:50093958-50093980 CTGGGTAAAAAGAGGGCAGGTGG - Intronic
1024715433 7:52074645-52074667 CTGTGGCACAGGAGACCAGAAGG + Intergenic
1025602166 7:63011273-63011295 TTGTTGCACGAGGGGGCAGGTGG + Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026352686 7:69531316-69531338 CTGTGGCAAAGGAGGGATGGGGG + Intergenic
1026886774 7:73954337-73954359 CTGTGGCCCAAGACTGCTGGAGG - Intergenic
1026944479 7:74307030-74307052 CTGAGTCACACGAGGGCAGGTGG + Intronic
1027269552 7:76512275-76512297 CTGAGGCACAGGAGGTCAAGTGG + Intronic
1027320263 7:77006169-77006191 CTGAGGCACAGGAGGTCAAGTGG + Intergenic
1028728512 7:94117376-94117398 CAGAGGCACAAAAGGGCAAGTGG + Intergenic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029284800 7:99458116-99458138 CTGTGGCACAAGGTGGGGGGAGG - Intronic
1030249469 7:107426552-107426574 ATATGGCAGAAGAGGGCAAGAGG + Intronic
1031127042 7:117786579-117786601 CTGTGGAACAGGAGGGAATGGGG + Intronic
1031996374 7:128234540-128234562 CTGAGGCACATGCGGGTAGGAGG + Intergenic
1032083804 7:128873236-128873258 CTGAGGCTCAACCGGGCAGGAGG - Intronic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1032638901 7:133742919-133742941 CTTTGCCACCAGAGGGCAGTTGG - Intronic
1032706405 7:134424035-134424057 CTGTGAGGGAAGAGGGCAGGTGG + Intergenic
1034095535 7:148404699-148404721 CTGGGTACCAAGAGGGCAGGGGG - Intronic
1035381899 7:158445798-158445820 CTGTGGCTCACGGGGACAGGAGG - Intronic
1035546556 8:486277-486299 CCCTGGCCCAGGAGGGCAGGTGG + Intergenic
1035595545 8:854480-854502 CTGTAGCAGAAGGGGGGAGGTGG + Intergenic
1038275241 8:26115824-26115846 CTGAGACACAAGAGAGCATGAGG - Intergenic
1038425801 8:27463101-27463123 CTGAGGCCCCAGAGTGCAGGTGG + Exonic
1038485641 8:27933135-27933157 CTGCAGCCCAAGAGGGCAGCAGG - Intronic
1039824104 8:41158221-41158243 CATTGGCACAAGAGGTCTGGAGG + Intergenic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1044966506 8:97579126-97579148 ATGTGGCATCAGAGGCCAGGTGG - Intergenic
1046717747 8:117585992-117586014 ATGTGGCATAGGAGGGGAGGGGG + Intergenic
1047346264 8:124031700-124031722 CTGAGAGATAAGAGGGCAGGAGG + Intronic
1048639059 8:136332552-136332574 CTGTGGTACCAAAAGGCAGGAGG + Intergenic
1049020146 8:139951055-139951077 CTGTGTCACAGGTGGGGAGGTGG - Intronic
1049795376 8:144494933-144494955 CTGTGTCTCTAGAGGGCAAGGGG + Intronic
1049920708 9:361180-361202 CTGTGACAGAGGAAGGCAGGGGG + Intronic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1053414381 9:37937877-37937899 CTGAGGCACAGGAAGGCAAGAGG - Intronic
1056280947 9:85040790-85040812 CTGTGTCCCAAGAGGGCAGCGGG - Intergenic
1056714906 9:89020924-89020946 GTGTGCCACCATAGGGCAGGAGG - Intronic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057405594 9:94767978-94768000 TTGTGGCACAAGAAAGCAAGAGG + Intronic
1057457209 9:95225436-95225458 CTGGGGCACAATAGGGGAAGAGG + Intronic
1057492540 9:95532511-95532533 CTCAGGCAACAGAGGGCAGGTGG - Intergenic
1058189704 9:101898335-101898357 GTGTGTGGCAAGAGGGCAGGGGG + Intergenic
1060690712 9:125656833-125656855 CAGAGACACAAGAAGGCAGGGGG + Intronic
1060739264 9:126087509-126087531 CTGTGTCATAACATGGCAGGAGG + Intergenic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1061080719 9:128368360-128368382 CTGAGGCACAAGCTGGGAGGCGG - Intergenic
1061542462 9:131284976-131284998 CTGTGGGACACGTGGCCAGGAGG + Intergenic
1061675388 9:132212702-132212724 CTTGGGCACTAGAGGGAAGGAGG - Intronic
1062035533 9:134380977-134380999 ATGTGGCCCCAGCGGGCAGGAGG + Intronic
1062052460 9:134454678-134454700 CTGAGGCAGGAGAGGGGAGGAGG - Intergenic
1185763916 X:2708979-2709001 CTGTGGCCTCTGAGGGCAGGTGG + Intronic
1187185525 X:16981181-16981203 CTGTGGGACAAGAAAGGAGGAGG - Intronic
1192072355 X:67954331-67954353 CTGTGGCTCAAGGAGGCAGCTGG + Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192860030 X:75057884-75057906 CAGTGGCACAAGAGGGTCTGTGG + Intronic
1193444095 X:81577978-81578000 CTGTGAGACAAGTGGTCAGGTGG - Intergenic
1199516479 X:148682384-148682406 CTGTGGCCCATGGTGGCAGGAGG - Intronic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1200054395 X:153451250-153451272 CTGTGGCACCATAGGACTGGTGG - Intronic
1200079105 X:153566765-153566787 CAGTGGCACAGGCGGGCAGAGGG - Intronic
1200206526 X:154320398-154320420 AAGTAGCACAAGAGGGGAGGAGG + Intronic