ID: 1122290807

View in Genome Browser
Species Human (GRCh38)
Location 14:100679517-100679539
Sequence GGGCCTCAGTTTCCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122290807_1122290817 24 Left 1122290807 14:100679517-100679539 CCAGCTTGGGGAAACTGAGGCCC No data
Right 1122290817 14:100679564-100679586 TTACACAGTTCATGGATGGCAGG No data
1122290807_1122290818 25 Left 1122290807 14:100679517-100679539 CCAGCTTGGGGAAACTGAGGCCC No data
Right 1122290818 14:100679565-100679587 TACACAGTTCATGGATGGCAGGG No data
1122290807_1122290815 16 Left 1122290807 14:100679517-100679539 CCAGCTTGGGGAAACTGAGGCCC No data
Right 1122290815 14:100679556-100679578 GATCAAAGTTACACAGTTCATGG No data
1122290807_1122290816 20 Left 1122290807 14:100679517-100679539 CCAGCTTGGGGAAACTGAGGCCC No data
Right 1122290816 14:100679560-100679582 AAAGTTACACAGTTCATGGATGG No data
1122290807_1122290811 -6 Left 1122290807 14:100679517-100679539 CCAGCTTGGGGAAACTGAGGCCC No data
Right 1122290811 14:100679534-100679556 AGGCCCAGAGGGACAAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122290807 Original CRISPR GGGCCTCAGTTTCCCCAAGC TGG (reversed) Intergenic
No off target data available for this crispr