ID: 1122290813

View in Genome Browser
Species Human (GRCh38)
Location 14:100679538-100679560
Sequence TGATCCAGGCCTTGTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122290813_1122290815 -5 Left 1122290813 14:100679538-100679560 CCAGAGGGACAAGGCCTGGATCA No data
Right 1122290815 14:100679556-100679578 GATCAAAGTTACACAGTTCATGG No data
1122290813_1122290818 4 Left 1122290813 14:100679538-100679560 CCAGAGGGACAAGGCCTGGATCA No data
Right 1122290818 14:100679565-100679587 TACACAGTTCATGGATGGCAGGG No data
1122290813_1122290817 3 Left 1122290813 14:100679538-100679560 CCAGAGGGACAAGGCCTGGATCA No data
Right 1122290817 14:100679564-100679586 TTACACAGTTCATGGATGGCAGG No data
1122290813_1122290816 -1 Left 1122290813 14:100679538-100679560 CCAGAGGGACAAGGCCTGGATCA No data
Right 1122290816 14:100679560-100679582 AAAGTTACACAGTTCATGGATGG No data
1122290813_1122290819 10 Left 1122290813 14:100679538-100679560 CCAGAGGGACAAGGCCTGGATCA No data
Right 1122290819 14:100679571-100679593 GTTCATGGATGGCAGGGCTCAGG No data
1122290813_1122290820 11 Left 1122290813 14:100679538-100679560 CCAGAGGGACAAGGCCTGGATCA No data
Right 1122290820 14:100679572-100679594 TTCATGGATGGCAGGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122290813 Original CRISPR TGATCCAGGCCTTGTCCCTC TGG (reversed) Intergenic
No off target data available for this crispr