ID: 1122290817

View in Genome Browser
Species Human (GRCh38)
Location 14:100679564-100679586
Sequence TTACACAGTTCATGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122290812_1122290817 4 Left 1122290812 14:100679537-100679559 CCCAGAGGGACAAGGCCTGGATC No data
Right 1122290817 14:100679564-100679586 TTACACAGTTCATGGATGGCAGG No data
1122290813_1122290817 3 Left 1122290813 14:100679538-100679560 CCAGAGGGACAAGGCCTGGATCA No data
Right 1122290817 14:100679564-100679586 TTACACAGTTCATGGATGGCAGG No data
1122290807_1122290817 24 Left 1122290807 14:100679517-100679539 CCAGCTTGGGGAAACTGAGGCCC No data
Right 1122290817 14:100679564-100679586 TTACACAGTTCATGGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122290817 Original CRISPR TTACACAGTTCATGGATGGC AGG Intergenic
No off target data available for this crispr