ID: 1122290818

View in Genome Browser
Species Human (GRCh38)
Location 14:100679565-100679587
Sequence TACACAGTTCATGGATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122290814_1122290818 -10 Left 1122290814 14:100679552-100679574 CCTGGATCAAAGTTACACAGTTC No data
Right 1122290818 14:100679565-100679587 TACACAGTTCATGGATGGCAGGG No data
1122290807_1122290818 25 Left 1122290807 14:100679517-100679539 CCAGCTTGGGGAAACTGAGGCCC No data
Right 1122290818 14:100679565-100679587 TACACAGTTCATGGATGGCAGGG No data
1122290812_1122290818 5 Left 1122290812 14:100679537-100679559 CCCAGAGGGACAAGGCCTGGATC No data
Right 1122290818 14:100679565-100679587 TACACAGTTCATGGATGGCAGGG No data
1122290813_1122290818 4 Left 1122290813 14:100679538-100679560 CCAGAGGGACAAGGCCTGGATCA No data
Right 1122290818 14:100679565-100679587 TACACAGTTCATGGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122290818 Original CRISPR TACACAGTTCATGGATGGCA GGG Intergenic
No off target data available for this crispr