ID: 1122291167

View in Genome Browser
Species Human (GRCh38)
Location 14:100681217-100681239
Sequence GGTCCCCAGCGGGCTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122291167_1122291184 26 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291184 14:100681266-100681288 GAGCAGAAGCGAGGGGGCATGGG No data
1122291167_1122291185 29 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291185 14:100681269-100681291 CAGAAGCGAGGGGGCATGGGTGG No data
1122291167_1122291175 -7 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291175 14:100681233-100681255 GGGGACCGGAGGGGCTGATGTGG No data
1122291167_1122291179 18 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291179 14:100681258-100681280 AGTGCCTGGAGCAGAAGCGAGGG No data
1122291167_1122291180 19 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291180 14:100681259-100681281 GTGCCTGGAGCAGAAGCGAGGGG No data
1122291167_1122291178 17 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291178 14:100681257-100681279 GAGTGCCTGGAGCAGAAGCGAGG No data
1122291167_1122291186 30 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291186 14:100681270-100681292 AGAAGCGAGGGGGCATGGGTGGG No data
1122291167_1122291177 4 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291177 14:100681244-100681266 GGGCTGATGTGGAGAGTGCCTGG No data
1122291167_1122291181 20 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291181 14:100681260-100681282 TGCCTGGAGCAGAAGCGAGGGGG No data
1122291167_1122291183 25 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291183 14:100681265-100681287 GGAGCAGAAGCGAGGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122291167 Original CRISPR GGTCCCCAGCGGGCTGCTCA GGG (reversed) Intergenic
No off target data available for this crispr