ID: 1122291168

View in Genome Browser
Species Human (GRCh38)
Location 14:100681218-100681240
Sequence CGGTCCCCAGCGGGCTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122291168_1122291185 28 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291185 14:100681269-100681291 CAGAAGCGAGGGGGCATGGGTGG No data
1122291168_1122291183 24 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291183 14:100681265-100681287 GGAGCAGAAGCGAGGGGGCATGG No data
1122291168_1122291180 18 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291180 14:100681259-100681281 GTGCCTGGAGCAGAAGCGAGGGG No data
1122291168_1122291178 16 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291178 14:100681257-100681279 GAGTGCCTGGAGCAGAAGCGAGG No data
1122291168_1122291179 17 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291179 14:100681258-100681280 AGTGCCTGGAGCAGAAGCGAGGG No data
1122291168_1122291184 25 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291184 14:100681266-100681288 GAGCAGAAGCGAGGGGGCATGGG No data
1122291168_1122291175 -8 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291175 14:100681233-100681255 GGGGACCGGAGGGGCTGATGTGG No data
1122291168_1122291186 29 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291186 14:100681270-100681292 AGAAGCGAGGGGGCATGGGTGGG No data
1122291168_1122291177 3 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291177 14:100681244-100681266 GGGCTGATGTGGAGAGTGCCTGG No data
1122291168_1122291181 19 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291181 14:100681260-100681282 TGCCTGGAGCAGAAGCGAGGGGG No data
1122291168_1122291187 30 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291187 14:100681271-100681293 GAAGCGAGGGGGCATGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122291168 Original CRISPR CGGTCCCCAGCGGGCTGCTC AGG (reversed) Intergenic
No off target data available for this crispr