ID: 1122291173

View in Genome Browser
Species Human (GRCh38)
Location 14:100681227-100681249
Sequence CAGCCCCTCCGGTCCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122291173_1122291179 8 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291179 14:100681258-100681280 AGTGCCTGGAGCAGAAGCGAGGG No data
1122291173_1122291185 19 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291185 14:100681269-100681291 CAGAAGCGAGGGGGCATGGGTGG No data
1122291173_1122291181 10 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291181 14:100681260-100681282 TGCCTGGAGCAGAAGCGAGGGGG No data
1122291173_1122291177 -6 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291177 14:100681244-100681266 GGGCTGATGTGGAGAGTGCCTGG No data
1122291173_1122291183 15 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291183 14:100681265-100681287 GGAGCAGAAGCGAGGGGGCATGG No data
1122291173_1122291189 28 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291189 14:100681278-100681300 GGGGGCATGGGTGGGGCAGTGGG No data
1122291173_1122291178 7 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291178 14:100681257-100681279 GAGTGCCTGGAGCAGAAGCGAGG No data
1122291173_1122291186 20 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291186 14:100681270-100681292 AGAAGCGAGGGGGCATGGGTGGG No data
1122291173_1122291188 27 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG No data
1122291173_1122291187 21 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291187 14:100681271-100681293 GAAGCGAGGGGGCATGGGTGGGG No data
1122291173_1122291180 9 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291180 14:100681259-100681281 GTGCCTGGAGCAGAAGCGAGGGG No data
1122291173_1122291184 16 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291184 14:100681266-100681288 GAGCAGAAGCGAGGGGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122291173 Original CRISPR CAGCCCCTCCGGTCCCCAGC GGG (reversed) Intergenic
No off target data available for this crispr