ID: 1122291176

View in Genome Browser
Species Human (GRCh38)
Location 14:100681238-100681260
Sequence ACTCTCCACATCAGCCCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122291176_1122291187 10 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291187 14:100681271-100681293 GAAGCGAGGGGGCATGGGTGGGG No data
1122291176_1122291188 16 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG No data
1122291176_1122291178 -4 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291178 14:100681257-100681279 GAGTGCCTGGAGCAGAAGCGAGG No data
1122291176_1122291190 24 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291190 14:100681285-100681307 TGGGTGGGGCAGTGGGCTGAAGG No data
1122291176_1122291183 4 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291183 14:100681265-100681287 GGAGCAGAAGCGAGGGGGCATGG No data
1122291176_1122291184 5 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291184 14:100681266-100681288 GAGCAGAAGCGAGGGGGCATGGG No data
1122291176_1122291179 -3 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291179 14:100681258-100681280 AGTGCCTGGAGCAGAAGCGAGGG No data
1122291176_1122291185 8 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291185 14:100681269-100681291 CAGAAGCGAGGGGGCATGGGTGG No data
1122291176_1122291180 -2 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291180 14:100681259-100681281 GTGCCTGGAGCAGAAGCGAGGGG No data
1122291176_1122291186 9 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291186 14:100681270-100681292 AGAAGCGAGGGGGCATGGGTGGG No data
1122291176_1122291181 -1 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291181 14:100681260-100681282 TGCCTGGAGCAGAAGCGAGGGGG No data
1122291176_1122291189 17 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291189 14:100681278-100681300 GGGGGCATGGGTGGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122291176 Original CRISPR ACTCTCCACATCAGCCCCTC CGG (reversed) Intergenic
No off target data available for this crispr