ID: 1122291178

View in Genome Browser
Species Human (GRCh38)
Location 14:100681257-100681279
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122291167_1122291178 17 Left 1122291167 14:100681217-100681239 CCCTGAGCAGCCCGCTGGGGACC No data
Right 1122291178 14:100681257-100681279 GAGTGCCTGGAGCAGAAGCGAGG No data
1122291173_1122291178 7 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291178 14:100681257-100681279 GAGTGCCTGGAGCAGAAGCGAGG No data
1122291176_1122291178 -4 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291178 14:100681257-100681279 GAGTGCCTGGAGCAGAAGCGAGG No data
1122291174_1122291178 6 Left 1122291174 14:100681228-100681250 CCGCTGGGGACCGGAGGGGCTGA No data
Right 1122291178 14:100681257-100681279 GAGTGCCTGGAGCAGAAGCGAGG No data
1122291168_1122291178 16 Left 1122291168 14:100681218-100681240 CCTGAGCAGCCCGCTGGGGACCG No data
Right 1122291178 14:100681257-100681279 GAGTGCCTGGAGCAGAAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122291178 Original CRISPR GAGTGCCTGGAGCAGAAGCG AGG Intergenic