ID: 1122291182

View in Genome Browser
Species Human (GRCh38)
Location 14:100681262-100681284
Sequence TGCCCCCTCGCTTCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122291182_1122291188 -8 Left 1122291182 14:100681262-100681284 CCTGGAGCAGAAGCGAGGGGGCA No data
Right 1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG No data
1122291182_1122291193 16 Left 1122291182 14:100681262-100681284 CCTGGAGCAGAAGCGAGGGGGCA No data
Right 1122291193 14:100681301-100681323 CTGAAGGAGTGCGTGGGTTGTGG No data
1122291182_1122291191 9 Left 1122291182 14:100681262-100681284 CCTGGAGCAGAAGCGAGGGGGCA No data
Right 1122291191 14:100681294-100681316 CAGTGGGCTGAAGGAGTGCGTGG No data
1122291182_1122291190 0 Left 1122291182 14:100681262-100681284 CCTGGAGCAGAAGCGAGGGGGCA No data
Right 1122291190 14:100681285-100681307 TGGGTGGGGCAGTGGGCTGAAGG No data
1122291182_1122291192 10 Left 1122291182 14:100681262-100681284 CCTGGAGCAGAAGCGAGGGGGCA No data
Right 1122291192 14:100681295-100681317 AGTGGGCTGAAGGAGTGCGTGGG No data
1122291182_1122291189 -7 Left 1122291182 14:100681262-100681284 CCTGGAGCAGAAGCGAGGGGGCA No data
Right 1122291189 14:100681278-100681300 GGGGGCATGGGTGGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122291182 Original CRISPR TGCCCCCTCGCTTCTGCTCC AGG (reversed) Intergenic
No off target data available for this crispr