ID: 1122291189

View in Genome Browser
Species Human (GRCh38)
Location 14:100681278-100681300
Sequence GGGGGCATGGGTGGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122291173_1122291189 28 Left 1122291173 14:100681227-100681249 CCCGCTGGGGACCGGAGGGGCTG No data
Right 1122291189 14:100681278-100681300 GGGGGCATGGGTGGGGCAGTGGG No data
1122291174_1122291189 27 Left 1122291174 14:100681228-100681250 CCGCTGGGGACCGGAGGGGCTGA No data
Right 1122291189 14:100681278-100681300 GGGGGCATGGGTGGGGCAGTGGG No data
1122291176_1122291189 17 Left 1122291176 14:100681238-100681260 CCGGAGGGGCTGATGTGGAGAGT No data
Right 1122291189 14:100681278-100681300 GGGGGCATGGGTGGGGCAGTGGG No data
1122291182_1122291189 -7 Left 1122291182 14:100681262-100681284 CCTGGAGCAGAAGCGAGGGGGCA No data
Right 1122291189 14:100681278-100681300 GGGGGCATGGGTGGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122291189 Original CRISPR GGGGGCATGGGTGGGGCAGT GGG Intergenic
No off target data available for this crispr