ID: 1122296128

View in Genome Browser
Species Human (GRCh38)
Location 14:100706614-100706636
Sequence GCTGCTGTTGCCCCCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122296128_1122296130 -5 Left 1122296128 14:100706614-100706636 CCAGCTTTGGGGGCAACAGCAGC No data
Right 1122296130 14:100706632-100706654 GCAGCTCTCACGGCTGCAGTCGG No data
1122296128_1122296132 23 Left 1122296128 14:100706614-100706636 CCAGCTTTGGGGGCAACAGCAGC No data
Right 1122296132 14:100706660-100706682 CCCCCCACCTCCAAACCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122296128 Original CRISPR GCTGCTGTTGCCCCCAAAGC TGG (reversed) Intergenic
No off target data available for this crispr