ID: 1122297198

View in Genome Browser
Species Human (GRCh38)
Location 14:100712257-100712279
Sequence GACAGCCCACCGGGAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122297198_1122297211 23 Left 1122297198 14:100712257-100712279 CCATGGGTTCCCGGTGGGCTGTC No data
Right 1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG No data
1122297198_1122297204 2 Left 1122297198 14:100712257-100712279 CCATGGGTTCCCGGTGGGCTGTC No data
Right 1122297204 14:100712282-100712304 CAGACTTCGTCCCCTGCCTCAGG No data
1122297198_1122297213 27 Left 1122297198 14:100712257-100712279 CCATGGGTTCCCGGTGGGCTGTC No data
Right 1122297213 14:100712307-100712329 CACAGAGGCAATGTGCCGGTAGG No data
1122297198_1122297207 12 Left 1122297198 14:100712257-100712279 CCATGGGTTCCCGGTGGGCTGTC No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
1122297198_1122297205 3 Left 1122297198 14:100712257-100712279 CCATGGGTTCCCGGTGGGCTGTC No data
Right 1122297205 14:100712283-100712305 AGACTTCGTCCCCTGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122297198 Original CRISPR GACAGCCCACCGGGAACCCA TGG (reversed) Intergenic
No off target data available for this crispr