ID: 1122297201

View in Genome Browser
Species Human (GRCh38)
Location 14:100712279-100712301
Sequence GAGGCAGGGGACGAAGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122297201_1122297217 28 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data
1122297201_1122297213 5 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297213 14:100712307-100712329 CACAGAGGCAATGTGCCGGTAGG No data
1122297201_1122297207 -10 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
1122297201_1122297211 1 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG No data
1122297201_1122297218 29 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297218 14:100712331-100712353 AACAGCATCTGGGCCCTCCAGGG No data
1122297201_1122297214 18 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297214 14:100712320-100712342 TGCCGGTAGGCAACAGCATCTGG No data
1122297201_1122297215 19 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122297201 Original CRISPR GAGGCAGGGGACGAAGTCTG GGG (reversed) Intergenic
No off target data available for this crispr