ID: 1122297202

View in Genome Browser
Species Human (GRCh38)
Location 14:100712280-100712302
Sequence TGAGGCAGGGGACGAAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122297202_1122297213 4 Left 1122297202 14:100712280-100712302 CCCAGACTTCGTCCCCTGCCTCA No data
Right 1122297213 14:100712307-100712329 CACAGAGGCAATGTGCCGGTAGG No data
1122297202_1122297214 17 Left 1122297202 14:100712280-100712302 CCCAGACTTCGTCCCCTGCCTCA No data
Right 1122297214 14:100712320-100712342 TGCCGGTAGGCAACAGCATCTGG No data
1122297202_1122297218 28 Left 1122297202 14:100712280-100712302 CCCAGACTTCGTCCCCTGCCTCA No data
Right 1122297218 14:100712331-100712353 AACAGCATCTGGGCCCTCCAGGG No data
1122297202_1122297215 18 Left 1122297202 14:100712280-100712302 CCCAGACTTCGTCCCCTGCCTCA No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data
1122297202_1122297217 27 Left 1122297202 14:100712280-100712302 CCCAGACTTCGTCCCCTGCCTCA No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data
1122297202_1122297211 0 Left 1122297202 14:100712280-100712302 CCCAGACTTCGTCCCCTGCCTCA No data
Right 1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122297202 Original CRISPR TGAGGCAGGGGACGAAGTCT GGG (reversed) Intergenic
No off target data available for this crispr