ID: 1122297207

View in Genome Browser
Species Human (GRCh38)
Location 14:100712292-100712314
Sequence CCCCTGCCTCAGGGCCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122297198_1122297207 12 Left 1122297198 14:100712257-100712279 CCATGGGTTCCCGGTGGGCTGTC No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
1122297191_1122297207 22 Left 1122297191 14:100712247-100712269 CCCCGCTGGCCCATGGGTTCCCG No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
1122297201_1122297207 -10 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
1122297200_1122297207 2 Left 1122297200 14:100712267-100712289 CCGGTGGGCTGTCCCCAGACTTC No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
1122297199_1122297207 3 Left 1122297199 14:100712266-100712288 CCCGGTGGGCTGTCCCCAGACTT No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
1122297192_1122297207 21 Left 1122297192 14:100712248-100712270 CCCGCTGGCCCATGGGTTCCCGG No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
1122297189_1122297207 28 Left 1122297189 14:100712241-100712263 CCTGCTCCCCGCTGGCCCATGGG No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
1122297197_1122297207 13 Left 1122297197 14:100712256-100712278 CCCATGGGTTCCCGGTGGGCTGT No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
1122297194_1122297207 20 Left 1122297194 14:100712249-100712271 CCGCTGGCCCATGGGTTCCCGGT No data
Right 1122297207 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122297207 Original CRISPR CCCCTGCCTCAGGGCCACAG AGG Intergenic
No off target data available for this crispr