ID: 1122297209

View in Genome Browser
Species Human (GRCh38)
Location 14:100712294-100712316
Sequence TGCCTCTGTGGCCCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122297209_1122297215 4 Left 1122297209 14:100712294-100712316 CCTGCCTCAGGGCCACAGAGGCA No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data
1122297209_1122297217 13 Left 1122297209 14:100712294-100712316 CCTGCCTCAGGGCCACAGAGGCA No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data
1122297209_1122297213 -10 Left 1122297209 14:100712294-100712316 CCTGCCTCAGGGCCACAGAGGCA No data
Right 1122297213 14:100712307-100712329 CACAGAGGCAATGTGCCGGTAGG No data
1122297209_1122297218 14 Left 1122297209 14:100712294-100712316 CCTGCCTCAGGGCCACAGAGGCA No data
Right 1122297218 14:100712331-100712353 AACAGCATCTGGGCCCTCCAGGG No data
1122297209_1122297214 3 Left 1122297209 14:100712294-100712316 CCTGCCTCAGGGCCACAGAGGCA No data
Right 1122297214 14:100712320-100712342 TGCCGGTAGGCAACAGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122297209 Original CRISPR TGCCTCTGTGGCCCTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr