ID: 1122297211

View in Genome Browser
Species Human (GRCh38)
Location 14:100712303-100712325
Sequence GGGCCACAGAGGCAATGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122297200_1122297211 13 Left 1122297200 14:100712267-100712289 CCGGTGGGCTGTCCCCAGACTTC No data
Right 1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG No data
1122297203_1122297211 -1 Left 1122297203 14:100712281-100712303 CCAGACTTCGTCCCCTGCCTCAG No data
Right 1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG No data
1122297198_1122297211 23 Left 1122297198 14:100712257-100712279 CCATGGGTTCCCGGTGGGCTGTC No data
Right 1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG No data
1122297197_1122297211 24 Left 1122297197 14:100712256-100712278 CCCATGGGTTCCCGGTGGGCTGT No data
Right 1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG No data
1122297201_1122297211 1 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG No data
1122297199_1122297211 14 Left 1122297199 14:100712266-100712288 CCCGGTGGGCTGTCCCCAGACTT No data
Right 1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG No data
1122297202_1122297211 0 Left 1122297202 14:100712280-100712302 CCCAGACTTCGTCCCCTGCCTCA No data
Right 1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122297211 Original CRISPR GGGCCACAGAGGCAATGTGC CGG Intergenic
No off target data available for this crispr