ID: 1122297215

View in Genome Browser
Species Human (GRCh38)
Location 14:100712321-100712343
Sequence GCCGGTAGGCAACAGCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122297212_1122297215 -8 Left 1122297212 14:100712306-100712328 CCACAGAGGCAATGTGCCGGTAG No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data
1122297206_1122297215 6 Left 1122297206 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data
1122297202_1122297215 18 Left 1122297202 14:100712280-100712302 CCCAGACTTCGTCCCCTGCCTCA No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data
1122297201_1122297215 19 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data
1122297208_1122297215 5 Left 1122297208 14:100712293-100712315 CCCTGCCTCAGGGCCACAGAGGC No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data
1122297209_1122297215 4 Left 1122297209 14:100712294-100712316 CCTGCCTCAGGGCCACAGAGGCA No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data
1122297203_1122297215 17 Left 1122297203 14:100712281-100712303 CCAGACTTCGTCCCCTGCCTCAG No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data
1122297210_1122297215 0 Left 1122297210 14:100712298-100712320 CCTCAGGGCCACAGAGGCAATGT No data
Right 1122297215 14:100712321-100712343 GCCGGTAGGCAACAGCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122297215 Original CRISPR GCCGGTAGGCAACAGCATCT GGG Intergenic
No off target data available for this crispr