ID: 1122297217

View in Genome Browser
Species Human (GRCh38)
Location 14:100712330-100712352
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122297212_1122297217 1 Left 1122297212 14:100712306-100712328 CCACAGAGGCAATGTGCCGGTAG No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data
1122297203_1122297217 26 Left 1122297203 14:100712281-100712303 CCAGACTTCGTCCCCTGCCTCAG No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data
1122297206_1122297217 15 Left 1122297206 14:100712292-100712314 CCCCTGCCTCAGGGCCACAGAGG No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data
1122297201_1122297217 28 Left 1122297201 14:100712279-100712301 CCCCAGACTTCGTCCCCTGCCTC No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data
1122297202_1122297217 27 Left 1122297202 14:100712280-100712302 CCCAGACTTCGTCCCCTGCCTCA No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data
1122297210_1122297217 9 Left 1122297210 14:100712298-100712320 CCTCAGGGCCACAGAGGCAATGT No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data
1122297208_1122297217 14 Left 1122297208 14:100712293-100712315 CCCTGCCTCAGGGCCACAGAGGC No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data
1122297209_1122297217 13 Left 1122297209 14:100712294-100712316 CCTGCCTCAGGGCCACAGAGGCA No data
Right 1122297217 14:100712330-100712352 CAACAGCATCTGGGCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122297217 Original CRISPR CAACAGCATCTGGGCCCTCC AGG Intergenic