ID: 1122297504

View in Genome Browser
Species Human (GRCh38)
Location 14:100713666-100713688
Sequence TGGAGTAAAGACAGCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122297501_1122297504 -3 Left 1122297501 14:100713646-100713668 CCGAAGGGGGACCAAGATCATGG No data
Right 1122297504 14:100713666-100713688 TGGAGTAAAGACAGCACTGATGG No data
1122297494_1122297504 23 Left 1122297494 14:100713620-100713642 CCGATGGAGAGGTTCATGCTGGG No data
Right 1122297504 14:100713666-100713688 TGGAGTAAAGACAGCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122297504 Original CRISPR TGGAGTAAAGACAGCACTGA TGG Intergenic
No off target data available for this crispr