ID: 1122297980

View in Genome Browser
Species Human (GRCh38)
Location 14:100716176-100716198
Sequence GTGTTTATGGGCATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122297976_1122297980 11 Left 1122297976 14:100716142-100716164 CCTCTCTGTTTCTATAAAGACAA No data
Right 1122297980 14:100716176-100716198 GTGTTTATGGGCATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122297980 Original CRISPR GTGTTTATGGGCATTGAGGA AGG Intergenic
No off target data available for this crispr