ID: 1122298081

View in Genome Browser
Species Human (GRCh38)
Location 14:100716745-100716767
Sequence AGAGATCCACACTCAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122298081_1122298088 13 Left 1122298081 14:100716745-100716767 CCCCCCACTGAGTGTGGATCTCT No data
Right 1122298088 14:100716781-100716803 TGAGGTGCTACCCACCTTCATGG No data
1122298081_1122298090 23 Left 1122298081 14:100716745-100716767 CCCCCCACTGAGTGTGGATCTCT No data
Right 1122298090 14:100716791-100716813 CCCACCTTCATGGTCCAGTAAGG No data
1122298081_1122298087 -5 Left 1122298081 14:100716745-100716767 CCCCCCACTGAGTGTGGATCTCT No data
Right 1122298087 14:100716763-100716785 TCTCTGTTGTCTAGTGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122298081 Original CRISPR AGAGATCCACACTCAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr