ID: 1122298682

View in Genome Browser
Species Human (GRCh38)
Location 14:100719698-100719720
Sequence CTGGCTGCAGACAGCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122298673_1122298682 4 Left 1122298673 14:100719671-100719693 CCCCTGCGCTCCGTCCCTAGCTG No data
Right 1122298682 14:100719698-100719720 CTGGCTGCAGACAGCCAGCTTGG No data
1122298672_1122298682 21 Left 1122298672 14:100719654-100719676 CCACTCACACTGGGCATCCCCTG No data
Right 1122298682 14:100719698-100719720 CTGGCTGCAGACAGCCAGCTTGG No data
1122298679_1122298682 -10 Left 1122298679 14:100719685-100719707 CCCTAGCTGGATCCTGGCTGCAG No data
Right 1122298682 14:100719698-100719720 CTGGCTGCAGACAGCCAGCTTGG No data
1122298676_1122298682 2 Left 1122298676 14:100719673-100719695 CCTGCGCTCCGTCCCTAGCTGGA No data
Right 1122298682 14:100719698-100719720 CTGGCTGCAGACAGCCAGCTTGG No data
1122298678_1122298682 -6 Left 1122298678 14:100719681-100719703 CCGTCCCTAGCTGGATCCTGGCT No data
Right 1122298682 14:100719698-100719720 CTGGCTGCAGACAGCCAGCTTGG No data
1122298674_1122298682 3 Left 1122298674 14:100719672-100719694 CCCTGCGCTCCGTCCCTAGCTGG No data
Right 1122298682 14:100719698-100719720 CTGGCTGCAGACAGCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122298682 Original CRISPR CTGGCTGCAGACAGCCAGCT TGG Intergenic
No off target data available for this crispr